Báo cáo khoa học: "Implementing a Characterization of Genre for Automatic Genre Identification of Web Pages" pot

... towards a more dynamic view of a genre classification system. Automatic identification of text types and genres represents a great advantage in many fields because manual annotation is expensive ... Evans NLTG University of Brighton UK R.P.Evans@brighton.ac.uk Abstract In this paper, we propose an implementable characterization of genre suitable for a...

Ngày tải lên: 23/03/2014, 18:20

... problem of several possible answers and, in consequence, automatic evaluation has been tackled for years within another field of study: automatic summarisation (Hori et al., 2003; Lin and Hovy, 2003). ... several passages of texts has for a long time been a research prob- lem within the field of automatic summarisation. For each document it is possible to create several...

Ngày tải lên: 20/02/2014, 09:20

... peptide synthetases: the emerging view from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, ... Marburg, Germany Introduction Bacterial growth is strongly influenced by the availabil- ity of iron as an essential trace element employed as a cofactor [1]. The fact that the bioa...

Ngày tải lên: 16/02/2014, 09:20

... filter in an FL500 fluorescent plate reader. Statistical analysis Data were analyzed using prism 4 for Windows (GraphPad Software, Inc., San Diego, CA). Two-way ANOVA was used for assessment of dose–response ... increases in cytosolic [Ca 2+ ] in response to CsA and its analogs. Both the intra- cellular Ca 2+ chelator BAPTA and the extracellular Ca 2+ chelator EGTA caused significant atten...

Ngày tải lên: 30/03/2014, 08:20

... overhead asso- ciated with adding types to the grammar. The major grammatical category plays a spe- cial role in the typing scheme of Gemini. For each category, Gemini makes a set of declarations ... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that...

Ngày tải lên: 20/02/2014, 21:20

... systems for the syntactic analysis of substantial fragments of natural language. These developments also demonstrate that if natural language processing systems are to be able to handle the grammatical ... the informational structure of the dictionary. Similarly, choice of font can be varied for reasons of appearance and occasionally information normally associated with o...

Ngày tải lên: 22/02/2014, 09:20

... contain a bric -a- brac, tramtrak and broad complex (BTB) domain that is most simi- lar to the tetramerization domain (T1) of voltage-gated potassium chan- nels. Some BTB-domain-containing proteins have ... The Authors Journal compilation ª 2008 FEBS KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases Yolanda Bayo ´ n 1 , Antonio G. Trinidad 1 , Marı a L. de la Puerta...

Ngày tải lên: 07/03/2014, 06:20

... state of the art. A manual error analysis reveals that parser errors account for many of the errors of our system. This analysis also suggests that simultaneous incremental parsing and semantic ... discussion of future research for computational se- mantics with CCG (Section 12). 2 Combinatory Categorial Grammar Combinatory Categorial Grammar (Steedman, 2000) is a grammatical...

Ngày tải lên: 17/03/2014, 01:20

... to amplify the cDNA containing the procarboxypeptidase by PCR. Sense primer 5¢-GATTCT CTCGAGAAAAGAAAACATGAAATTT ATGATGG-3¢; antisense primer 5¢-CTTCTTTGAGT TATGACGAATT GGATCCTAC-3¢. The original ... CPAHa. Degradation of V15E (VKKKARKAAGC(Acm)AWE) 1 by CPA1 h, CPBh mutant 2 (cleaves acidic C-ter residues) and CPAHa. Degradation of V14R (VKKKARKAAGGAKR) by CPA1 h, CPBh and CPAHa. Degradati...

Ngày tải lên: 17/03/2014, 03:20

... annotated text corpora. While the XML standard specifies a data model and serialization format for XML, a semantics is largely left to be defined for a particular ap- plication. Many data models can ... project treat anno- tation data in XML from any source as separate annotation layers, provided the text nodes in each layer contain the same base data. The base data is extracted and k...

Ngày tải lên: 17/03/2014, 04:20