Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Structural and serological studies on a new 4-deoxy- D - arabino -hexose- containing O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) Ewa Katzenellenbogen 1 , ... (C) of the lipopolysaccharide (LPS)-I (lane 1) and LPS-II (lane 2) of C. braakii PCM 1531, LPS of Citrobacter PCM 1504 (...

Ngày tải lên: 23/03/2014, 17:22

... b-strands, six a- helices and three 3 10 -helices. The core of the pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella ... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site...

Ngày tải lên: 18/02/2014, 14:20

... with the exception that sonication was used instead of high pressure homogenization, the purification was conducted on an A ¨ KTAxpress system (GE Healthcare). Crystallization, data collection and ... nucleotide being added to crystallization solutions. The ligand bound was interpreted as GMP because the N2 of the base makes a hydrogen bond to a main chain car- bonyl. B...

Ngày tải lên: 15/02/2014, 01:20

... 000 A ˚ 2 ) as con- tact area. Thus, a large amount of the available surface area of the molecule is buried upon pentamerization, increasing the stability of the protein. The hAd2 ⁄ 12 penton base ... base, [Lig B ] is the concentration of the bound ligand (minifiber), and [Lig tot ] is the total con- centration of the ligand. At any total concentration of l...

Ngày tải lên: 19/02/2014, 06:20

... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel- opment (blastula, gastrula, trochophore larvae, D lar- vae, 7 and ... in synapse regulation and ⁄ or maintenance [15,16]. As part of an ongoing project to understand the role of the TGF-b superfamily ligands, their receptors and signal transduc...

Ngày tải lên: 07/03/2014, 21:20

... conformational space of b-aminoacidsislargerthanthatofa-amino acids, but low-energy conformations of the b-amino acids backbone, corresponding to gauche rotamers around the Ca–Cb bond, can overlap canonical ... conventional techniques [37]. The chemical shifts of a carbon (Ca) have been assigned from HSQC spectra (data not shown). The chemical shift deviations of Ha proton...

Ngày tải lên: 08/03/2014, 08:20

... represents the fractional residual activity of the partial active enzyme intermediate, and k fast and k slow are the rate constants for the slow a nd fast phase of the reaction. Analysis was performed ... binds at one site at all stages of the reaction. The best explanation for these results may be that the reaction of SDTG at the binding site of one subunit...

Ngày tải lên: 16/03/2014, 16:20

... 50 and near 100%) [63,77]. At this point, the data suggest that K eq A and the associated k on and k off conforma- tional rates are primary factors in regulating the cyto- chrome c reductase activity ... domain has fundamen- tal structural, thermodynamic and mechanistic features in common with the dual-flavin family of reductases, there are unique aspects related to NO s...

Ngày tải lên: 18/02/2014, 11:20

... reduction during the reaction of the wild-type (wt) and N18 9A mutant of MR with NADH. The wt trace is fit to a single exponential and the N18 9A trace to a 4-exponential function – see the main text ... substrate-binding titrations and crystallo- graphic studies when a very large amount of the sub- strate may be required; typical NAD(P)H saturation constants...

Ngày tải lên: 18/02/2014, 11:20

... in favour of a stronger H-bond between the carbonyl of N58 (‘O-up’ conformation) and FMN N(5)H [41]. The semiquinone states of A. nidulans and Anabaena Flds are less stable than those from other species ... both of the large PSI subunits, PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE are located at the...

Ngày tải lên: 18/02/2014, 11:20