Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

... were 5¢- GTAACTGTAAGAGAACTGGTCAC- 3¢ (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- 3¢ (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- 3¢ (Lys70 to Tyr). The resulting plasmids, pUCYPKR, pUCYPKA, and ... Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion...

Ngày tải lên: 23/03/2014, 17:21

... short-lived species for the initial incorporation of AA into the PtdIns class of cellular phospholipids in human monocytes. Abbreviations AA, arachidonic acid; BEL, bromoenol lactone; cPLA 2 , calcium-dependent ... arachidonic acid (AA) incorporate large quantities of this fatty acid into choline and ethanolamine glycero- phospholipids, and into phosphatidylinositol (PtdIns)....

Ngày tải lên: 23/03/2014, 06:20

... of complex containing MT1- MMP and furin, and the expression of a catalytically inactive dominant negative furin construct affected the processing of pro-MT1-MMP. Taken together, these data reveal ... immunoprecipi- tated with the FLAG antibody and the associated MT1-MMP was detected by IB using the MYC tag antibody. Top black arrowheads indicate IgGs. The bottom bla...

Ngày tải lên: 18/02/2014, 04:20

... reverse, 5¢- GACCTTCTTCTCCCGCATCATC- 3¢. VEGF: forward, 5¢- ACGAAAGCGCAAGAAATCCC- 3¢; and reverse, 5¢- TTAACTCAAGCTGCCTCGCC- 3¢. Beta-actin: forward, 5¢- AGGCTCTTTTCCAGCCTTCCT- 3¢; and reverse, 5¢- GTCTTTACGGATGTCAACGTCACA- 3¢. Xenograft ... discriminate aggregates. siRNA-mediated knockdown of HIF- 1a and VHL expression The DNA sequence corresponding to...

Ngày tải lên: 18/02/2014, 13:20

... as the cells entered G 1 and then increasing again as the cells approached and entered S phase. The same pattern of variation of iPLA 2 activity was detected whether the assay was conducted with ... iPLA 2 ,asa sn-2 lipase, may also participate in generating free fatty acids such as AA, which could subsequently be metab- olized to eicosanoids. The importance of AA and...

Ngày tải lên: 18/02/2014, 17:20

... comparison of secondary struc- ture data ) from the crystal structure in the case of CYP102 – and predicted using jpred [38] in the case of CYP4x1. Coordinates for the main chain atoms of aligned CYP4x1 ... showing that Cyp4x1 is a major brain P450. Immunohistochemical localization of the Cyp4x1 protein in brain showed speci c staining of neurons, choroids epi...

Ngày tải lên: 19/02/2014, 07:20

... rhythmicity of the principal circadian clock located within the suprachiasmatic nucleus (SCN) is entrained predominantly by a light–dark cycle through pathways emanating from retinal photoreceptors. Via ... field and their implications. 1.5 Signaling and Cancer: Nuclear Receptor Connection S1.5-1 Androgen action and prostate carcinogenesis F. Saatc¸ iog ˘ lu Division of Cellula...

Ngày tải lên: 19/02/2014, 07:20

... with respect to C5 of the synthetic deazaflavin and others to be Re-face stereospeci c [7,8]. In case of the pyridine-nucleotide-dependent enzymes the redox potential (E°) of the electron acceptor reduced ... Stereochemical studies of a selenium-containing hydrogenase from Methanococcus vannielii: determination of the absolute configuration of C- 5 chirally la...

Ngày tải lên: 20/02/2014, 03:20

... (defendending), martina, jovotna, navratilova GERMAN '01: TOPIC 91 ES AI in Lateinamerika La gripe aviar en América Latina AI in Latin America 0.456 0.098 international, amnesty, strassenkind ... Linguistics Multilingual Pseudo-Relevance Feedback: Performance Study of Assisting Languages Manoj K. Chinnakotla Karthik Raman Pushpak Bhattacharyya Department of Computer Science...

Ngày tải lên: 20/02/2014, 04:20

... Linguistics Lexicographic Semirings for Exact Automata Encoding of Sequence Models Brian Roark, Richard Sproat, and Izhak Shafran {roark,rws,zak}@cslu.ogi.edu Abstract In this paper we introduce a novel ... with a brief evaluation of the cost of intersection relative to failure transitions in comparable situations. 2 The Lexicographic Semiring Weighted automata are autom...

Ngày tải lên: 20/02/2014, 04:20