Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

... were 5¢- GTAACTGTAAGAGAACTGGTCAC- 3¢ (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- 3¢ (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- 3¢ (Lys70 to Tyr). The resulting plasmids, pUCYPKR, pUCYPKA, and ... Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion...

Ngày tải lên: 23/03/2014, 17:21

7 384 1
Báo cáo khoa học: Calcium-independent phospholipase A2-mediated formation of 1,2-diarachidonoyl-glycerophosphoinositol in monocytes potx

Báo cáo khoa học: Calcium-independent phospholipase A2-mediated formation of 1,2-diarachidonoyl-glycerophosphoinositol in monocytes potx

... short-lived species for the initial incorporation of AA into the PtdIns class of cellular phospholipids in human monocytes. Abbreviations AA, arachidonic acid; BEL, bromoenol lactone; cPLA 2 , calcium-dependent ... arachidonic acid (AA) incorporate large quantities of this fatty acid into choline and ethanolamine glycero- phospholipids, and into phosphatidylinositol (PtdIns)....

Ngày tải lên: 23/03/2014, 06:20

12 330 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... of complex containing MT1- MMP and furin, and the expression of a catalytically inactive dominant negative furin construct affected the processing of pro-MT1-MMP. Taken together, these data reveal ... immunoprecipi- tated with the FLAG antibody and the associated MT1-MMP was detected by IB using the MYC tag antibody. Top black arrowheads indicate IgGs. The bottom bla...

Ngày tải lên: 18/02/2014, 04:20

18 603 0
Tài liệu Báo cáo khoa học: Hypoxia-inducible factor-1a blocks differentiation of malignant gliomas pdf

Tài liệu Báo cáo khoa học: Hypoxia-inducible factor-1a blocks differentiation of malignant gliomas pdf

... reverse, 5¢- GACCTTCTTCTCCCGCATCATC- 3¢. VEGF: forward, 5¢- ACGAAAGCGCAAGAAATCCC- 3¢; and reverse, 5¢- TTAACTCAAGCTGCCTCGCC- 3¢. Beta-actin: forward, 5¢- AGGCTCTTTTCCAGCCTTCCT- 3¢; and reverse, 5¢- GTCTTTACGGATGTCAACGTCACA- 3¢. Xenograft ... discriminate aggregates. siRNA-mediated knockdown of HIF- 1a and VHL expression The DNA sequence corresponding to...

Ngày tải lên: 18/02/2014, 13:20

14 568 0
Tài liệu Báo cáo khoa học: Calcium-independent phospholipase A2 mediates proliferation of human promonocytic U937 cells pptx

Tài liệu Báo cáo khoa học: Calcium-independent phospholipase A2 mediates proliferation of human promonocytic U937 cells pptx

... as the cells entered G 1 and then increasing again as the cells approached and entered S phase. The same pattern of variation of iPLA 2 activity was detected whether the assay was conducted with ... iPLA 2 ,asa sn-2 lipase, may also participate in generating free fatty acids such as AA, which could subsequently be metab- olized to eicosanoids. The importance of AA and...

Ngày tải lên: 18/02/2014, 17:20

10 450 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... comparison of secondary struc- ture data ) from the crystal structure in the case of CYP102 – and predicted using jpred [38] in the case of CYP4x1. Coordinates for the main chain atoms of aligned CYP4x1 ... showing that Cyp4x1 is a major brain P450. Immunohistochemical localization of the Cyp4x1 protein in brain showed speci c staining of neurons, choroids epi...

Ngày tải lên: 19/02/2014, 07:20

12 466 0
Tài liệu Báo cáo khoa học: 1. Signal Transduction 1.1 Integration of Metabolism and Survival pdf

Tài liệu Báo cáo khoa học: 1. Signal Transduction 1.1 Integration of Metabolism and Survival pdf

... rhythmicity of the principal circadian clock located within the suprachiasmatic nucleus (SCN) is entrained predominantly by a light–dark cycle through pathways emanating from retinal photoreceptors. Via ... field and their implications. 1.5 Signaling and Cancer: Nuclear Receptor Connection S1.5-1 Androgen action and prostate carcinogenesis F. Saatc¸ iog ˘ lu Division of Cellula...

Ngày tải lên: 19/02/2014, 07:20

6 525 0
Tài liệu Báo cáo khoa học: Si-face stereospecificity at C5 of coenzyme F420 for F420H2 oxidase from methanogenic Archaea as determined by mass spectrometry ppt

Tài liệu Báo cáo khoa học: Si-face stereospecificity at C5 of coenzyme F420 for F420H2 oxidase from methanogenic Archaea as determined by mass spectrometry ppt

... with respect to C5 of the synthetic deazaflavin and others to be Re-face stereospeci c [7,8]. In case of the pyridine-nucleotide-dependent enzymes the redox potential (E°) of the electron acceptor reduced ... Stereochemical studies of a selenium-containing hydrogenase from Methanococcus vannielii: determination of the absolute configuration of C- 5 chirally la...

Ngày tải lên: 20/02/2014, 03:20

6 361 1
Tài liệu Báo cáo khoa học: "Multilingual Pseudo-Relevance Feedback: Performance Study of Assisting Languages" doc

Tài liệu Báo cáo khoa học: "Multilingual Pseudo-Relevance Feedback: Performance Study of Assisting Languages" doc

... (defendending), martina, jovotna, navratilova GERMAN '01: TOPIC 91 ES AI in Lateinamerika La gripe aviar en América Latina AI in Latin America 0.456 0.098 international, amnesty, strassenkind ... Linguistics Multilingual Pseudo-Relevance Feedback: Performance Study of Assisting Languages Manoj K. Chinnakotla Karthik Raman Pushpak Bhattacharyya Department of Computer Science...

Ngày tải lên: 20/02/2014, 04:20

11 327 0
Tài liệu Báo cáo khoa học: "Lexicographic Semirings for Exact Automata Encoding of Sequence Models" pdf

Tài liệu Báo cáo khoa học: "Lexicographic Semirings for Exact Automata Encoding of Sequence Models" pdf

... Linguistics Lexicographic Semirings for Exact Automata Encoding of Sequence Models Brian Roark, Richard Sproat, and Izhak Shafran {roark,rws,zak}@cslu.ogi.edu Abstract In this paper we introduce a novel ... with a brief evaluation of the cost of intersection relative to failure transitions in comparable situations. 2 The Lexicographic Semiring Weighted automata are autom...

Ngày tải lên: 20/02/2014, 04:20

5 407 0
w