Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

... domains of different bacterial and plant protein toxins, including ricin [8], PEA [2,3] cholera toxin and Shiga toxin, can exploit the ERAD pathways [1,4,14] to reach their targets in the cytosol ... Spring Harbor, NY. R. Vago et al. Saporin trafficking in intoxicated mammalian cells FEBS Journal 272 (2005) 4983–4995 ª 2005 FEBS 4995 Saporin and ricin A chain...

Ngày tải lên: 23/03/2014, 15:21

... the corpus. In order to distinguish between available new data and data already present in the corpus, the URLs of all available data from the website are matched against the IDs of the already ... Conclusions and Future Work We presented an ontology-based approach to information extraction in the soccer domain that aims at the automatic generation of a knowled...

Ngày tải lên: 22/02/2014, 02:20

... 'illes' is 'they' rather than 'them;' that 'finir' is substantive, and that 'paises' requires 'many' rather than 'much,' a rote translation ... part by the National Science Founda- tion and in part by the U.S. Army Signal Corps, the Air Force Office of Scientific Research, and the Office of Naval Rese...

Ngày tải lên: 23/03/2014, 13:20

... includes au- tomatic generation of Grammatical Frame- work (GF) grammars for robust interpretation of spontaneous speech, and uses application databases to gen e rate lexical entries and gram- mar rules. ... following agents in addition to DIPPER: Grammatical Framework (GF) parser (Ranta, 2004) (java) BPM agent (java) and Database agent (java) HTK spee c h recognizer (Young, 199...

Ngày tải lên: 22/02/2014, 02:20

... USA Introduction Upon catalyzing the cleavage of RNA, RNases operate at the crossroads of transcription and translation. Bovine pancreatic RNase A (EC 3.1.27.5) is the best characterized RNase. A notoriously stable ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase...

Ngày tải lên: 14/02/2014, 22:20

... cardiac fibrosis in a paracrine manner under ischaemic conditions. Taken together, these findings may improve understanding of the cellu- lar and molecular basis of the anti-inflammatory and paracrine ... which may be an important mediator of the cells paracrine anti-fibrotic effects. These findings help to improve our understanding of the cellular and molecular basis o...

Ngày tải lên: 18/02/2014, 04:20

... DNA sequences flanking the Jannaschia sp. CCS1 HYD Js revealed an ORF encoding a putative allantoate amido- hydrolase, which is part of the urate catabolic pathway in many organisms [8]. In fact, by ... 2FTW was selected as a template by a BLAST search, as it has the highest sequence identity to HYD Js of all available crystal structures. The coordinates for zinc atoms and...

Ngày tải lên: 18/02/2014, 08:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of the ... coordinated by the carboxyl oxygen atoms of D8, D9, by the carboxamide oxygen of N92, by the hydroxyl oxygen of S39 and by the oxygen atoms of two water mole...

Ngày tải lên: 18/02/2014, 14:20

... and part of the His-tag was observed in the B chain. A few amino acid residues are found in disallowed regions in the Ramachandran plot; these are A4 , A1 65, A1 67, B3, B4 and F165, all of which are ... was mutated to Asn or Ala. The mutant enzymes, F133N and F13 3A, were expressed, purified and characterized. With 1 mm UMP and ATP as substrates, the activities...

Ngày tải lên: 18/02/2014, 16:20

... TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified PCR product was inserted into the ... of the exact reaction mechanisms. The tyrosinase structure, wherein the active site was located at the bottom of a large vacant space and one of the six his- tidine lig...

Ngày tải lên: 19/02/2014, 06:20