Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

... 5¢-GAATTGGCCCTAATTTGCACATTAAAGATA-3¢ Antisense: 5¢-GCCTGAAGTTTTTGGTTCACAGTGAAATTT-3¢ SULT1 ST4 Sense: 5¢-ACACTCTGAAGGGGAATTAGGATTAAGAAA-3¢ Antisense: 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ SULT1 ST5 Sense: 5¢-GAAAACACATCACGTACCCTCCCTCTCTGCG-3¢ Antisense: ... 5¢-AGTTCAACAAGGAACTGCAGGACGTGTTTG-3¢ Antisense: 5¢-CACATGGCTATAAAATGGTTACATCTGTGT-3¢ SULT1 ST2 Sense: 5¢-TATGTAGGAGCTACAAGAAACATTGAA...

Ngày tải lên: 23/03/2014, 15:20

10 336 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... and the localization of Starmaker in zebrafish. Dev Genes Evol 214, 582–590. 26 Murayama E, Okuno A, Ohira T, Takagi Y & Nagasa- wa H (2000) Molecular cloning and expression of an otolith matrix ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can form metasta...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... 1000 (Table 1). Core oligosaccharide from the 1000 galE mutant strain was also prepared and examined by MS. A range of molecular masses was found for the core oligosaccharide consistent with a composition ... (1075), an additional phosphate group and an additional PEtn moiety (1155) and one additional phosphate group and two additional PEtn moieties (1278). Relative intensit...

Ngày tải lên: 08/03/2014, 02:20

8 361 1
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC 2– G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCC 1– GGGC aagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG 2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTG...

Ngày tải lên: 17/03/2014, 03:20

8 401 0
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

... for angiotensin II receptor (AT 1a) cDNA cloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ (forward); 5¢-CCCTTTGGAAACTGGACAGA-3¢ (reverse). Primers used for cannabinoid receptor-1 (CB-1) cDNA cloning: 5¢-GAGGACCAGGGGATGCGAAGG-3¢;5¢-TG CCCCCTGTGGGTCACTTTCT-3¢. Plasmids ... Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues Yanbin Liang, Chen Li, Victor M. Gu...

Ngày tải lên: 23/03/2014, 13:20

9 312 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... were purchased from Sigma. DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction enzyme analysis were performed by the standard methods ... 11718–11728. 27. Watanabe,S.,Muramatsu,T.,Ao,H.,Hirayama,Y.,Takahashi, K., Tanokura, M. & Kuchino, Y. (1999) Molecular cloning of the LonproteasegenefromThermus thermophilus...

Ngày tải lên: 16/03/2014, 16:20

11 505 0
Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

... 5¢-ACTCAAATCACTAGTATTCTTCCACCA-3¢ and 5¢-CATTTGAACATAAACATGAACAAATAAGTT-3¢ and the following conditions: annealing temperature 55 °C, 25 cycles, Phusion polymerase used according to the manufacturer’s ... PhosphorImager. The percentage of release from position 2 was calculated as follows: area fatty acid ⁄ (area fatty acid + area lysoPtdCho). Pancreatic PLA2 was used as a positive c...

Ngày tải lên: 22/03/2014, 17:20

14 395 0
Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

... (5¢-AATAGA GAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not (5¢-TCATAAGGCGGCCGCCTACATCG ATCTTAATCTGCTCAA-3¢). A fragment carrying At3g21260 cDNA was amplifed from A. thaliana RNA by RT-PCR. RNA was isolated from ... GLTP1PRON- BAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAA GGTGGG-3¢). A 1.3 kb fragment carrying the At1g21360 promoter was amplified using primers 21360PRUXBA (5¢-AACGATCTAGATTAA...

Ngày tải lên: 23/03/2014, 07:20

17 300 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

... GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme protein identification in M. capsulatus O. A. Karlsen ... would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa. A search in the PROSITE database of protein families and domains [12] with MCA2590...

Ngày tải lên: 23/03/2014, 11:20

12 393 0
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

... Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka, Japan 2 Department of Biological Sciences, Faculty of Science, Kanagawa University, Hiratsuka, Kanagawa, Japan Although ... bovine adrenal gland ferritin; and lanes 3 and 6, the 250 kDa protein. Identification of a putative MAP as ferritin M. R. Hasan et al. 824 FEBS Journal 272 (2...

Ngày tải lên: 23/03/2014, 13:20

10 232 0
w