Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx
... active phosphite dehydrogenase mutant and its application for NADPH regeneration Ryan Woodyer1, Huimin Zhao2 and Wilfred A van der Donk1,31 Department of Chemistry, University of Illinois at ... reduction of NADP. Phosphite concentrations (labeled orunlabeled) were held at 2 mM and the assay was started by theaddition of 2 lgofHis6-tagged PTDH in each assay. The data wasanalyzed (Table ... affinity of a cofactor regeneration enzyme for its cofactor substrate and product is an important param-eter. Therefore, the dissociation constants (KD) for thecofactor substrates and products...
- 12
- 368
- 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... 25% of the accessiblesurface area of a monomer contributes to LlPDHdimer formation. Whereas LlPDH and OaPDH have a buried surface area of 5500 A ˚2, TbPDH has a largerinterface surface area ... smaller compound PEA(Fig. 1B) and a water molecule are present and PEX and PEA refined satisfactorily with occupancies of 0.7Table 1. Data and refinement statistics. Values in parentheses pertain ... suite: programs for protein crystallo-graphy.Acta Crystallogr D Biol Crystallogr 50, 760–763.28 Navaza J (1994) Amore – an automated package for molecular replacement. Acta Crystallogr A 50, 157–163.29...
- 12
- 452
- 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt
... TACATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeIfl-SpsB3 TAGAATTCTTAATTTTTAGTATTTTCAGG EcoRItr-SpsB5 TACATATGCACCATCACCATCACCATATTGTTACACCATATA NdeIpIsaA5 TACCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC ... TACCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoIIsaA3Myc TAGAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRIRao C. V. S. et al. S. aureus type I signal peptidase SpsBFEBS Journal 276 (2009) ... segment.Additionally, a truncated mutant in which the cata-lytic serine was replaced by alanine (data not shown)was used as a control in the FRET assay. This mutant had a kcat⁄ Kmvalue of 4...
- 13
- 464
- 0
Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx
... 39,507–510.21 Terada Y, Sanbe H, Takaha T, Kitahata S, KoizumiK & Okada S (2001) Comparative study of the cycliza-tion reactions of three bacterial cyclomaltodextrin glu-canotransferases. Appl Environ ... Tokyo,Japan. Rhizopus sp. glucoamylase was obtained from Toy-obo Co., Ltd (Osaka, Japan). BM CGTase was obtainedfrom Amano Enzyme Inc. (Aichi, Japan) and had a specificactivity of 1003 UÆmg)1 of ... derivatization was calculated according to Shetty & Kin-sella [29]:Derivatization degree ð%Þ¼½1 À A der =A natÞ Â 100where A der and A natare the absorbance values obtainedwith derivatized...
- 10
- 562
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... mutationsMousumi Banerjee1, Hemalatha Balaram2 and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... inenzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv ProteinChem 66, 315–372.45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)Disallowed Ramachandran ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... found to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involvedin ... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... absorption bands. Heme catabolism byHOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similarmechanism, because the characteristic absorptionbands of verdoheme ... degradation rate of GmHO-1, indi-cated in Table 4, is comparable to that of SynHO-1 inthe presence of NADPH, FNR, and Fd, and also tothat of rHO-1 in the presence of NADPH and CPR.Here, NADPH ... Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral features of the final reaction mixture were analogous, but not iden-tical,...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: An investigation of the substrate specificity of the xyloglucanase Cel74A from Hypocrea jecorina pdf
... consisting of a catalyticdomain, a linker region, and a C-terminal carbohy-drate-binding module. A high apparent molecular mass for intact Cel7 4A (105 kDa) was also reported byGrishutin et al. [6]. ... (Northampton, MA, USA). The ther-mal denaturation of Cel7 4A was completely irreversible, and no transition was seen in a repeat scan; therefore, anapparent Tmwas approximated as the midpoint of theDSC ... macromolecule, as well as for setting the grid and docking parameters. Minor variations of the standardLamarckian genetic algorithm parameter settings were used:the number of runs was set at 50, with a...
- 8
- 646
- 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... t-butyl alcohol to the reaction medium, namely, a better solubilization of thioanisole and an increase in thecatalytically active monomeric form of MP8.Fig. 2. Activators and inhibitors of the ... change of the Fe(II) spin state and noreplacement of any of the two axial ligands of the iron,His18 or RNO, by an amino acid side-chain of theantibody protein.Binding site topology of antibody ... the iron of MP8, it brings a partial steric hindrance on the distal face of MP8 and thus controls access of the nitrosoalcane ligandto the iron atom of MP8. Such a phenomenon has alreadybeen...
- 7
- 447
- 0
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
... The anchoring of a- carboxylate and a- amino group in the external aldimine definesautomatically the positions of the a- proton and the sidechain of any bound amino ac id. The lability of the a- protonobserved ... 568, and 754 min and treatedas above. The theoretical values of isotopic exchange rateswere calculated, based on the assumption that the number of operative active sites participating in reactions ... pathway responsible for the principaltransformation.Values of KSH and kf(H)correspond to KD and kf for thereaction of nondeuterated substrate, and KSD, kf(D) and kr(D)are equal, respectively,...
- 7
- 532
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam