Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

... active phosphite dehydrogenase mutant and its application for NADPH regeneration Ryan Woodyer 1 , Huimin Zhao 2 and Wilfred A van der Donk 1,3 1 Department of Chemistry, University of Illinois at ... reduction of NADP. Phosphite concentrations (labeled or unlabeled) were held at 2 m M and the assay was started by the addition of 2 lgofHis 6 -tagged PTDH in...

Ngày tải lên: 23/03/2014, 15:20

12 368 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

... 25% of the accessible surface area of a monomer contributes to Ll PDH dimer formation. Whereas LlPDH and OaPDH have a buried surface area of  5500 A ˚ 2 , TbPDH has a larger interface surface area ... smaller compound PEA (Fig. 1B) and a water molecule are present and PEX and PEA refined satisfactorily with occupancies of 0.7 Table 1. Data and refinement statistics....

Ngày tải lên: 19/02/2014, 05:20

12 452 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

... TA CATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeI fl-SpsB3 TA GAATTCTTAATTTTTAGTATTTTCAGG EcoRI tr-SpsB5 TA CATATGCACCATCACCATCACCATATTGTTACACCATATA NdeI pIsaA5 TA CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC ... TA CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoI IsaA3Myc TA GAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRI Rao C. V. S. et al. S. aureus type I sign...

Ngày tải lên: 07/03/2014, 01:20

13 464 0
Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

... 39, 507–510. 21 Terada Y, Sanbe H, Takaha T, Kitahata S, Koizumi K & Okada S (2001) Comparative study of the cycliza- tion reactions of three bacterial cyclomaltodextrin glu- canotransferases. Appl Environ ... Tokyo, Japan. Rhizopus sp. glucoamylase was obtained from Toy- obo Co., Ltd (Osaka, Japan). BM CGTase was obtained from Amano Enzyme Inc. (Aichi, Japan) and had a specific ac...

Ngày tải lên: 07/03/2014, 10:20

10 562 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal ... in enzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can form metastable aragonite crystals ... found to have a molecular mass of 64 kDa, and to contain two tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... degradation rate of GmHO-1, indi- cated in Table 4, is comparable to that of SynHO-1 in the presence of NADPH, FNR, and Fd, and also to that of rHO-1 in the pres...

Ngày tải lên: 19/02/2014, 05:20

16 618 0
Tài liệu Báo cáo khoa học: An investigation of the substrate specificity of the xyloglucanase Cel74A from Hypocrea jecorina pdf

Tài liệu Báo cáo khoa học: An investigation of the substrate specificity of the xyloglucanase Cel74A from Hypocrea jecorina pdf

... consisting of a catalytic domain, a linker region, and a C-terminal carbohy- drate-binding module. A high apparent molecular mass for intact Cel7 4A (105 kDa) was also reported by Grishutin et al. [6]. ... (Northampton, MA, USA). The ther- mal denaturation of Cel7 4A was completely irreversible, and no transition was seen in a repeat scan; therefore, an apparent T m was...

Ngày tải lên: 19/02/2014, 05:20

8 646 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... t-butyl alcohol to the reaction medium, namely, a better solubilization of thioanisole and an increase in the catalytically active monomeric form of MP8. Fig. 2. Activators and inhibitors of the ... change of the Fe(II) spin state and no replacement of any of the two axial ligands of the iron, His18 or RNO, by an amino acid side-chain of the antibody protein. Binding...

Ngày tải lên: 19/02/2014, 12:20

7 448 0
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

... The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino ac id. The lability of the a- proton observed ... 568, and 754 min and treated as above. The theoretical values of isotopic exchange rates were calculated, based on the assumption that the number of operat...

Ngày tải lên: 19/02/2014, 16:20

7 533 0
w