Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx
... aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation Luciano D’Agostino 1 , Massimiliano di Pietro 1 and Aldo Di Luccia 2 1 Department ... is the charge attraction between DNA phosphates and the amino groups of polyamines. As the amino groups of polyamines are already engaged...
Ngày tải lên: 23/03/2014, 15:20
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... changes being minimal the trapping of two main-chain confor- mations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in uence the dynamics of ... indicate that dissociation of the K100 occurs in a similar manner as for M100 coordination and that unlike at alkaline pH, unfolding using GdmHCl induces a ligand-exchang...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Nuclear localization of human spermine oxidase isoforms – possible implications in drug response and disease etiology pptx
... Systems, San Diego, CA, USA) using PCR with the primer pair 5¢-CAATC CTC GAGTATGCAAAGTTGTGAATCCAG-3¢ and 5¢-TAA T AAGCTTTGGTCCCCTGCTGGAAGAGGTC-3¢ and each cDNA in pET15b as the template. PCR products ... proximity to DNA, as well as decreases nuclear spermine levels, thus altering the protec- tive roles of spermine in free radical scavenging and DNA shielding, and resulting...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Nuclear import of mPER3 in Xenopus oocytes and HeLa cells requires complex formation with mPER1 pdf
... Emery-Le M, Rosbash M & Allada R (2002) A role for casein kinase 2alpha in the Drosophila circadian clock. Nature 420, 816–820. 19 Martinek S, Inonog S, Manoukian AS & Young MW (2001) A role for ... phosphoryla- tion and nuclear transfer of mPER3 [33]. Phosphoryla- tion of mPER1 itself correlates with nuclear transport [34]. Earlier studies had already indicated t...
Ngày tải lên: 30/03/2014, 20:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 9903 10318 415 C. Gijavanekar et al. PCR detection...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf
... Suzuki 5 and Yasushi Kawata 3,4 1 National Institute of Advanced Industrial Science and Technology, Ikeda, Osaka, Japan 2 Department of Food Science and Nutrition, Faculty of Human Life and Science, ... Academia Sinica and National Synchrotron Radiation Research Center (Taiwan, ROC). We thank Ms M.Sakai (Osaka University) for performing ultracentrifugation analysis and Mr K....
Ngày tải lên: 14/02/2014, 22:20
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... inhibitor was maintained at 1 : 1000. After 1 h of preincubation, 2 mm Met was added, and the amount of a- keto acid was measured after 0, 12, 24 and 36 min, as described above. After the amount of a- keto- butyric ... transmethylation reactions, and the synthesis of polyamines, antioxidants, and cofactors [1]. As there are remarkable differences in trans-sulfuration pa...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx
... the NdeI–BamHI sites of pET-2 8a. This DNA fragment was amplified by PCR. The sequences of the PCR primers were 5¢-AGAGAGAATT CATATGTCAGATTTGTTCAG-3¢ for the 5¢-primer and 5¢-GGCCACT GGATCCAACT ACAGCAATTCTCA-3¢ ... mass of 28 kDa and an isoelectric point of four greatly increased at 4 °C compared to that at 20 °C. Determination of the N-terminal amino acid sequence, fol- low...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khóa học: Identification of domains on the extrinsic 23 kDa protein possibly involved in electrostatic interaction with the extrinsic 33 kDa protein in spinach photosystem II ppt
... structural determinants present on the spinach 33 kDa protein that are required for the efficient binding of the 23 and 17 kDa proteins and that are absent in cyanobacterial and red algal proteins [24]. The ... A ˚ span) indicated that the 33 kDa protein is within a distance of 11 A ˚ of the 23 kDa protein and that the 23 kDa protein is within 11 A ˚ of th...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Crystal structure of heme oxygenase-1 from cyanobacterium Synechocystis sp. PCC 6803 in complex with heme pot
... HO-1 and mammalian HO- 1 (in parentheses) are shown. Hydrogen bonding patterns in the ÔopenÕ and ÔclosedÕ conformations and in the Ômore closedÕ conformation are characterized by a- helix and p-helix, respectively. 4520 ... T., Matsuno, A. , M uraki, A. , Nakazaki, N., Naruo, K., Okumura, S., Shimpo, S., Takeuchi, C., Wada, T., Watanabe, A. , Yamada,M.,Yasuda,M.&Tab...
Ngày tải lên: 23/03/2014, 13:20