Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

... lack of automatic met- ric that is capable to measure all the three criteria in paraphrase generation. Two issues are also raised in (Zhao and Wang, 2010) about using automatic metrics: paraphrase ... another language F , each translation could have m candidates {e  } which may contain potential paraphrases for e s . Our task is to locate the candi- date that best fit in the demands...
Ngày tải lên : 23/03/2014, 14:20
  • 5
  • 347
  • 0
Báo cáo khoa học: "Bayesian Learning of a Tree Substitution Grammar" potx

Báo cáo khoa học: "Bayesian Learning of a Tree Substitution Grammar" potx

... obvious way to learn these grammars. In particular, learning procedures are not able to take direct advantage of manually an- notated corpora like the Penn Treebank, which are not marked for derivations ... Proceedings of the ACL-IJCNLP 2009 Conference Short Papers, pages 45–48, Suntec, Singapore, 4 August 2009. c 2009 ACL and AFNLP Bayesian Learning of a Tree Substitution Gram...
Ngày tải lên : 17/03/2014, 02:20
  • 4
  • 289
  • 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC 2– G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCC 1– GGGC aagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG 2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTG...
Ngày tải lên : 17/03/2014, 03:20
  • 8
  • 401
  • 0
Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

... TOC(0)(Beginning) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) 19 TOC(0)(End) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) 20 TOC(0)(Transition) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) 21 ... accuracy of automatic mor- phological analysis was lower than that of manual morphological analysis. As previously stated, to improve the accuracy of the whole corpus we tak...
Ngày tải lên : 17/03/2014, 06:20
  • 10
  • 398
  • 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... 389, 150–156. 33 Hitomi K, Kitamura M, Alea MP, Ceylan I, Thomas V & El Alaoui S (2009) A specific colorimetric assay for measuring of transglutaminase 1 and Factor XIII activi- ties. Anal Biochem 394, ... Graduate School of Bioagricultural Sciences, Nagoya University, Japan 2 CovalAb, Villeurbanne, France 3 Department of Dermatology, Hokkaido University Graduate School of Medi...
Ngày tải lên : 29/03/2014, 21:20
  • 11
  • 645
  • 0
Báo cáo khoa học: "Joint Learning Improves Semantic Role Labeling Kristina Toutanova Dept of Computer Science Stanford " pot

Báo cáo khoa học: "Joint Learning Improves Semantic Role Labeling Kristina Toutanova Dept of Computer Science Stanford " pot

... predi- cate. For example, this template will be instantiated as follows for the example candidate argument se- quence: [ voice:active ARG1,PRED,ARG4,ARGM-TMP] We also add a variant of this feature ... also report Frame Accu- racy (Acc.), the fraction of sentences for which we successfully label all nodes. There are reasons to prefer Frame Accuracy as a measure of performance o...
Ngày tải lên : 08/03/2014, 04:22
  • 8
  • 483
  • 0
Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

... 1999). Usually, entire documents are translated by humans, and the sentence pairs are subsequently aligned by automatic means. A small parallel corpus can be available when native speakers and translators ... given for Arabic , but the approach is applica- ble to any language that needs affix re- moval. Our resource-frugal approach re- sults in 87.5% agreement with a state of the art,...
Ngày tải lên : 08/03/2014, 04:22
  • 8
  • 424
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal ... in enzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disa...
Ngày tải lên : 18/02/2014, 11:20
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... nacreous layer formation of Pinctada fucata. FEBS Lett 462, 225–229. 5 Kono M, Hayashi N & Samata T (2000) Molecular mechanism of the nacreous layer formation in Pinctada maxima. Biochem ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can form metastable aragonite cryst...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu O f...
Ngày tải lên : 19/02/2014, 05:20
  • 16
  • 617
  • 0
Từ khóa: