Báo cáo khoa học: "Interlingua and MT, a Discussion" pptx
Báo cáo khoa học: "Interlingua and MT, a Discussion" pptx
... 'provas nuclear' and 'paises plus
parve,' and the multiple entries for 'provas,' 'multe,'
'paises,' 'plus,' and 'parve.'
The ... a hyphen in 'prima di' so that it becomes
'prima-di' (or 'prima-de'), and with the elimination of
the unattached &apos ;a& apos; of 'davanti a. &...
Tài liệu Báo cáo khoa học: "Generating and Visualizing a Soccer Knowledge Base" potx
... and
data already present in the corpus, the URLs of
all available data from the website are matched
against the IDs of the already extracted data.
2.2 Linguistic Annotation and Information
Extraction
As ... 9th
International Conference on applications of natural
language to information systems.
Maedche, Alexander, Günter Neumann and Steffen
Staab. 2002. Bootstrapping an Ontology-Based I...
Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx
... a
biotinylated anti-ATF conformational monoclonal serum
and human prourokinase as a standard [19]. The concentra-
tions of the saporin-based chimeras in the 72 h medium
were in the micromolar range.
Immunoprecipitation, ... , 37201–
37207.
18 Fabbrini MS, Rappocciolo E, Carpani D, Solinas M,
Valsasina B, Breme U, Cavallaro U, Nykjaer A, Rovida
E, Legname G et al. (1997) Characterizatio...
Báo cáo khoa học: " Focusing on focus: a formalization" pptx
... A DM consists of a stack of file cards,
and each card contains (maximally) three categories
of items, viz., discourse referent (serving as index to
and address of the card), attribute(s) and ... in IAZ
44 ELSE
45 IF Ce {CAz} at T¢ AND To- Tr- T,
46 THEN
47 DEPOSIT C in SAZ
Several notes are called for 3. First, what can be
2 Again here we are aware of the argument that acti...
Báo cáo khoa học: "Design and Scruffy Text Implementation" pptx
... expectations failed
because a clause boundary was not adequately marked
in the message; assume such a boundary is there.
NOMAD assumes that there may have been an intended
sentence separation ... reader, and am-
biguities; and even apparently very simple texts
may contain alternative possible interpretations,
which can cause a reader to construct erroneous
initial inferences...
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Functional and structural analyses of N-acylsulfonamide-
linked dinucleoside inhibitors of RNase A
Nethaji Thiyagarajan
1
, Bryan D. Smith
2,
*, Ronald T. Raines
2,3
and K. Ravi Acharya
1
1 Department ... nucleic acid-binding
proteins.
Database
Structural data for the two RNase A complexes are available in the Protein Data Bank under
accession numbers 2xog and 2xoi
Abbreviations
PDB...
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... Pesce JT, Ramalingam TR, Thompson RW,
Kamanaka M, Flavell RA, Keane-Myers A et al. (2007)
IL-13Ralpha2 and IL-10 coordinately suppress airway
inflammation, airway-hyperreactivity, and fibrosis ... China
Introduction
Ischaemic heart disease is a life-threatening condition
that may cause sudden cardiac failure and death.
Many researchers have investigated cell transplantation
as an alte...
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... molecular basis of enzyme thermosta-
bility. J Bacteriol 185, 4038–4049.
20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka
Y & Takahashi S (1997) Process for producing d-N-car-
bamoyl -a- amino acid. ... molecular mass
was also estimated by SDS–PAGE.
Characterization and comparative analyses of
HYD
Js
and HYD
Bp
The optimal temperature for activity of HYD
Js
with d-p-
HPH as substrate...
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaeal
triosephosphate isomerase adapted to high temperature.
J Mol Biol 342, 861–875.
12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S,
Balaram H, Balaram ... mutations
Mousumi Banerjee
1
, Hemalatha Balaram
2
and Padmanabhan Balaram
1
1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India
2 Molecular Biology and Genetic...
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template
using Deep Vent DNA polymerase (New England Biolabs,
Ipswich, MA, USA), a sense primer (CATATGGCTAGC
ATGCGCATATTGCTGAGTAAC) containing an NheI site
and an antisense primer (TTAGGATCCTTACCATTGCG
TGCCAACTCCCAC) ... pro-
tein is made up of a nine-stranded b-sheet flanked by
a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1
Structure of Salmonella typhimurium SurE A....
Từ khóa: