Báo cáo khoa học: "Interlingua and MT, a Discussion" pptx
... 'provas nuclear' and 'paises plus parve,' and the multiple entries for 'provas,' 'multe,' 'paises,' 'plus,' and 'parve.' The ... a hyphen in 'prima di' so that it becomes 'prima-di' (or 'prima-de'), and with the elimination of the unattached &apos ;a& apos; of 'davanti a. &...
Ngày tải lên: 23/03/2014, 13:20
... and data already present in the corpus, the URLs of all available data from the website are matched against the IDs of the already extracted data. 2.2 Linguistic Annotation and Information Extraction As ... 9th International Conference on applications of natural language to information systems. Maedche, Alexander, Günter Neumann and Steffen Staab. 2002. Bootstrapping an Ontology-Based I...
Ngày tải lên: 22/02/2014, 02:20
... a biotinylated anti-ATF conformational monoclonal serum and human prourokinase as a standard [19]. The concentra- tions of the saporin-based chimeras in the 72 h medium were in the micromolar range. Immunoprecipitation, ... , 37201– 37207. 18 Fabbrini MS, Rappocciolo E, Carpani D, Solinas M, Valsasina B, Breme U, Cavallaro U, Nykjaer A, Rovida E, Legname G et al. (1997) Characterizatio...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: " Focusing on focus: a formalization" pptx
... A DM consists of a stack of file cards, and each card contains (maximally) three categories of items, viz., discourse referent (serving as index to and address of the card), attribute(s) and ... in IAZ 44 ELSE 45 IF Ce {CAz} at T¢ AND To- Tr- T, 46 THEN 47 DEPOSIT C in SAZ Several notes are called for 3. First, what can be 2 Again here we are aware of the argument that acti...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo khoa học: "Design and Scruffy Text Implementation" pptx
... expectations failed because a clause boundary was not adequately marked in the message; assume such a boundary is there. NOMAD assumes that there may have been an intended sentence separation ... reader, and am- biguities; and even apparently very simple texts may contain alternative possible interpretations, which can cause a reader to construct erroneous initial inferences...
Ngày tải lên: 24/03/2014, 01:21
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and 2xoi Abbreviations PDB...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... Pesce JT, Ramalingam TR, Thompson RW, Kamanaka M, Flavell RA, Keane-Myers A et al. (2007) IL-13Ralpha2 and IL-10 coordinately suppress airway inflammation, airway-hyperreactivity, and fibrosis ... China Introduction Ischaemic heart disease is a life-threatening condition that may cause sudden cardiac failure and death. Many researchers have investigated cell transplantation as an alte...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaeal triosephosphate isomerase adapted to high temperature. J Mol Biol 342, 861–875. 12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S, Balaram H, Balaram ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetic...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) ... pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella typhimurium SurE A....
Ngày tải lên: 18/02/2014, 14:20