Báo cáo khoa học: "The Linguistic Basis of a Mechanical Thesaurus " doc

Báo cáo khoa học: "The Linguistic Basis of a Mechanical Thesaurus " doc

Báo cáo khoa học: "The Linguistic Basis of a Mechanical Thesaurus " doc

... form a thesaurus, and the thesaurus series is the lexical analogue of the grammatical paradigm. A FUNDAMENTAL problem of mechanical translation, arising at the levels of both gram- mar and ... lattice program originated and developed by Margaret Masterman and A. F. Parker- Rhodes. The lattice program, which is a mathematical generalization of a comparative gramma...
Ngày tải lên : 23/03/2014, 13:20
  • 8
  • 339
  • 0
Báo cáo khoa học: The structural basis of calpain behavior pptx

Báo cáo khoa học: The structural basis of calpain behavior pptx

... structurally inactive conformation of calpain 2. DIII is related to the spatial organization of the C2 domain and binds Ca 2+ ions and phospholipids. DIV, structurally similar to DVI, also contains ... for calpain 1 and 0.2–1 mm for cal- pain 2. A large range of substrates and a common inhibitor (calpastatin), also found in the nucleus, were identified. Knowledge of the 3D structur...
Ngày tải lên : 23/03/2014, 10:21
  • 2
  • 282
  • 0
Báo cáo khoa học: The molecular basis of heme oxygenase deficiency in the pcd1 mutant of pea pot

Báo cáo khoa học: The molecular basis of heme oxygenase deficiency in the pcd1 mutant of pea pot

... products of total RNA isola- ted from P. sativum cv. Solara using degenerate primers PS1.FOR 5¢-GAG GAN ATG AGN TTN GTN GCN ATG AGA-3¢ and PS1.REV 5¢-CCA CCA GCA NTA TGN GNA AAG TAG AT-3¢. Amplification ... (3¢-RACE) 5¢-CGG AAG AGA GAG CCG TGA CGA AGT G-3¢. The genomic PsHO1 sequence was amplified from total genomic DNA of P. sativum cv. Solara, cv. Torsdag and pcd1 using prim- ers PsHO1.FO...
Ngày tải lên : 30/03/2014, 11:20
  • 13
  • 402
  • 0
Tài liệu Báo cáo khoa học: "The Lexical Component of Natural Language Processing" docx

Tài liệu Báo cáo khoa học: "The Lexical Component of Natural Language Processing" docx

... no adequate system for natural language processing has approached human levels of performance. Of the various problems that natural language processing has re- vealed, polysemy is probably ... frustrating. People deal with polysemy so easily that potential abiguities are overlooked, whereas computers must work hard to do far less well. A linguistic approach generally involves a...
Ngày tải lên : 20/02/2014, 18:20
  • 2
  • 496
  • 0
Tài liệu Báo cáo khoa học: "The Rhetorical Parsing of Natural Language Texts" docx

Tài liệu Báo cáo khoa học: "The Rhetorical Parsing of Natural Language Texts" docx

... each analyst? The Spearman correlation coefficient 2The Spearman rank correlation coefficient is an alternative to the usual correlation coefficient. It is based on the ranks of the data, and ... be able to ac- commodate the ambiguity of discourse markers: in their axe independent of each other, against the alternative hypothesis that the rank of a variable is correlated with...
Ngày tải lên : 22/02/2014, 03:20
  • 8
  • 433
  • 0
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc

Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc

... minor bands at molecular masses of around 20 and 39– 41 kDa, which partly shifted from the major bands, coinciding with the appearance of a significant deacyla- tion activity. Any bacterial contamination ... its enzymatic activity against phospholipids suggest a role in the defence against invading microorganisms and in the generation of lipid mediators of inflammation. Abbreviation...
Ngày tải lên : 16/03/2014, 04:20
  • 12
  • 486
  • 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx

Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx

... Science and Technology (AIST), Tsukuba, Ibaraki, Japan 2 Research Institute of Genome-based Biofactory, National Institute of Advanced Industrial Science and Technology (AIST), Toyohira, Sapporo, ... backbone chain. Typically, treatment of an XXXG-type xyloglucan with these endoglucanases generates oligosaccharides with a tetrasaccharide backbone (XXXG). For many years, endo-b-1,4-glu...
Ngày tải lên : 23/03/2014, 05:22
  • 7
  • 361
  • 0
Báo cáo khoa học: The crystal structure of a hyperthermostable subfamily II isocitrate dehydrogenase from Thermotoga maritima pdf

Báo cáo khoa học: The crystal structure of a hyperthermostable subfamily II isocitrate dehydrogenase from Thermotoga maritima pdf

... D36N-1 5’-CATCCTTCCCTATCTC AACATCCAGCTGGTTTACT-3’ D341N-1 5’-AAGGGGAGAACTC AACGGAACACCGGAGG-3’ D389N 5’-CACTCTCGAAGAGTTCATA AACGAAGTGAAGAAGAATCTC-3’ 5’-GAGATTCTTCTTCACTTCGT TTATGAACTCTTCGAGAGTG-3’ M. Karlstro ¨ m ... 5’-CCTGGAGAAATCGATCA TGAGCTTCGCTCAGTCGTG-3’ 5’-CACGACTGAGCGAAGCT CATGATCGATTTCTCCAGG-3’ F205M 5’-AAAAGGTCGACATCTGG ATGGCGACGAAAGACACGATC-3’ 5’-GATCGTGTCTTTCGTCGC CATCCAGATGTCGACC...
Ngày tải lên : 23/03/2014, 10:21
  • 18
  • 410
  • 0
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

... thermoaerophilus were amplified from chromosomal DNA templates, using the following primer pairs: P. aeruginosa,5¢-AGGCCCGCTTC C GGATCCACTCAGCGTCTG-3¢ and 5¢-AAAAAAGTCG ACTTCTTCTCGTACCCGTGACTC-3¢; and A. thermo- aerophilus,5¢-TT GGATCCATGAGAGCCCTAATCACTG GA-3¢ ... collected at a wavelength of 1.0 A ˚ on a MAR CCD detector at the Advanced Photon Source Beamline 5-ID (DND) (Argonne Nati...
Ngày tải lên : 16/03/2014, 01:20
  • 15
  • 402
  • 0

Xem thêm