Aesthetics and learning by Bennyé D Austring, Merete C Sørensen ppt

Aesthetics and learning by Bennyé D. Austring, Merete C. Sørensen ppt

Aesthetics and learning by Bennyé D. Austring, Merete C. Sørensen ppt

... Aesthetics and learning Bennyé D. Austring, Merete C. Sørensen bau@ucsj.dk mso@ucsj.dk University College Sjælland (Denmark) Abstract This paper is built on our book " ;Aesthetics and ... aesthetic learning processes as an integrated part of the curriculum. Introduction Throughout the pedagogical and didactic debate these days, you often come across the concep...

Ngày tải lên: 23/03/2014, 13:20

5 384 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

... (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand 4 and a 37-bp duplex DNA by ... junc tion, J0, labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATT...

Ngày tải lên: 17/03/2014, 17:20

9 542 0
Herpesviridae – A Look into This Unique Family of Viruses Edited by George D. Magel and Stephen Tyring docx

Herpesviridae – A Look into This Unique Family of Viruses Edited by George D. Magel and Stephen Tyring docx

... progression in two different ways depending on the cell cycle phase. In quiescent cells, HSV-1 infection prevents G1 entry by inhibition of cyclin D/ CDK4,6-specific and cyclin E/CDK2-specific phosphorylation ... The Cdc2 catalityc subunit is inhibited by its phosphorylation at Thr14/Tyr15. Dephosphorylation of Cdc2 inhibitory sites by Cdc2 5C activates Cdc2-Cyclin B1 complex,...

Ngày tải lên: 08/03/2014, 00:20

330 1,8K 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx

... RMS, a computation that checks the accuracy of digitized points in ARC/INFO. It is the calculated distance between recorded points and specified reference points (TIC) and is expressed as a ... Caribou 8 to 15 CgC2 Caribou 8 to 15 eroded CgD Caribou 15 to 25 CgD2 Caribou 15 to 25 eroded CgE Caribou 25 to 45 CoA Conant silt loam 0 to 2 CoB Conant silt loam 2 to 8 CoC Conant silt lo...

Ngày tải lên: 08/03/2014, 23:20

131 599 0
Listening and Learning: the Ombudsman’s review of complaint handling by the NHS in England 2010-11 doc

Listening and Learning: the Ombudsman’s review of complaint handling by the NHS in England 2010-11 doc

... Practice about this. The Practice discussed the incident with Miss F and decided that the doctor-patient relationship with the family had broken down. The Practice asked the local primary care ... 19 Mother and baby removed without warning Ms D s baby daughter was due to be immunised. The day before the jabs were due, the GP Practice said they had miscalculated baby J’s age and...

Ngày tải lên: 19/03/2014, 07:20

45 704 0
Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

... they could succeed, school administrators stepped forward to advocate that school districts provide free and reduced breakfast and lunch pro- grams. Now it’s time for us to advocate for improved ... many can identify individual cases like the one cited by Cedar Rapids Supt. Dr. Lewis Finch: “A student in one of our middle schools had missed 33 days of school due to asthma by March of...

Ngày tải lên: 23/03/2014, 23:20

16 450 0
Báo cáo khoa học: "Learning and Translating by Machines" ppt

Báo cáo khoa học: "Learning and Translating by Machines" ppt

... language. Definition results by com- parison with related words. Can the meaning of words be specified by precise rules? Do these rules exist? A child of four can construct grammatical sentences ... pulled across a sensing device and the notes are played when a hole crosses the sensor. The pitch is determined by the value of one coordinate, and the position in time is determine...

Ngày tải lên: 30/03/2014, 17:20

3 273 0
optics learning by computing with examples using matlab - k.d. moller

optics learning by computing with examples using matlab - k.d. moller

... Application 1. FileFig 1.7 (G7SINGCX) Convex spherical surface. Calculation of image and object foci. Calculation of image coordinate for four specifically chosen object coordinates. G7SINGCX Convex ... have calculated the image point for four specifically chosen object points, discussed below. FileFig 1.6 (G6SINGCX) Graph of image coordinate depending on object coordinate for convex spherica...

Ngày tải lên: 08/04/2014, 10:27

459 565 0
Using information technology in teaching and learning reading skill of english for biology for 2nd-year students

Using information technology in teaching and learning reading skill of english for biology for 2nd-year students

... the students expect their teacher to be good at all the necessarily demanded techniques, ESP and communication skills. In other words, the teacher should be good, creative and dynamic. Hence, ... learn when the lecture is vivid and understandable”. The teachers who teach ESP should know this opinion to improve their methods of teaching with IT. A B C D A,B ,D C ,D B ,D A,B ,...

Ngày tải lên: 07/11/2012, 14:31

43 1,4K 6
w