Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

... Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein Cristina Lanni, Michela Mazzucchelli, Emanuela ... overexpres- sion of the PKCe V1 region, which binds specifically to the receptor for activated C -kinase (RACK), blocking the activation of the kinase specifically [1...

Ngày tải lên: 23/03/2014, 13:20

8 459 0
Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx

Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx

... Finland). The concentration of the oxidant in the samples was calculated using the standard curve, which was made by adding known concentrations of the authentic H 2 O 2 instead of the samples. Visualization ... examined the cytotoxic effects of selenoureas and selenoamides using three cell lines, HaCaT, HEL, and HEp-2, and PMNs, by the microtiter tetrazolium m...

Ngày tải lên: 23/03/2014, 07:20

9 331 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

... mm Ca 2+ . According to calculations using the spherical shape of macromolecules, the hydrodynamic radius of the protein will increase by 27% on formation of the dimer [22]. The increase in size ... activating the Ca 2+ release-activated Ca 2+ (CRAC) channel by first sensing the changes in Ca 2+ concentration in the endoplasmic reticulum ([Ca 2+ ] ER ) via its lum...

Ngày tải lên: 07/03/2014, 00:20

9 465 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... synthesize the N-terminal fragment of the poneratoxin gene. Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... poneratoxin gene [11]. Two oligonucleotides: forward 5¢- 2 GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢,...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
Báo cáo khoa học: Novel diadenosine polyphosphate analogs with oxymethylene bridges replacing oxygen in the polyphosphate chain pdf

Báo cáo khoa học: Novel diadenosine polyphosphate analogs with oxymethylene bridges replacing oxygen in the polyphosphate chain pdf

... as expected, none of the three enzymes can cleave the P–O bond in the P-O-CH 2 -P linkage. Second, the asymmetric cleaving enzymes accept the P-O -C- P bridge in the position adjacent to the P-O-P cleavage locus ... in the a,b active site. Taken together, the results of cleavage of compounds 3 and 5 show that the asymmetrically acting Ap 4 A hydro- lases can...

Ngày tải lên: 16/03/2014, 04:20

8 377 0
Báo cáo khoa học: "A Dynamic Bayesian Framework to Model Context and Memory in Edit Distance Learning: An Application to Pronunciation Classification" ppt

Báo cáo khoa học: "A Dynamic Bayesian Framework to Model Context and Memory in Edit Distance Learning: An Application to Pronunciation Classification" ppt

... Z; and consistency nodes sc and tc, which enforce the con- sistency constraint discussed in section 2. Because of symmetry we will explain the upper half of the graph involving the source string ... Distance introduced in the paper takes local statistical dependencies into account, the edit costs are still fixed and not corpus-driven. 4 The concept of d-separation...

Ngày tải lên: 23/03/2014, 19:20

8 398 0
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

... (2005) Relaxin-3 ⁄ insulin- like peptide 5 chimeric peptide, a selective ligand for G protein- coupled receptor (GPCR)135 and GPCR142 over leucine-rich repeat-containing G protein- coupled receptor ... expression in neurons of the nucleus incertus of the dorsal pons, and a few other regions of the brain- stem. On the other hand, relaxin-3-expressing nerve fibers and th...

Ngày tải lên: 29/03/2014, 21:20

8 370 0
Báo cáo khoa học: Tryptophan 243 affects interprotein contacts, cofactor binding and stability in D-amino acid oxidase from Rhodotorula gracilis ppt

Báo cáo khoa học: Tryptophan 243 affects interprotein contacts, cofactor binding and stability in D-amino acid oxidase from Rhodotorula gracilis ppt

... DAAO. Kinetics of reconstitution of apoprotein with FAD Because of the weaker binding of the FAD cofactor to the apoprotein of the W243 mutants, we studied the kinetics of reconstitution of the apoprotein–FAD ... titrating the apoprotein with increasing amounts of FAD and following the decrease in protein fluorescence: a K d value of 0.37 and 0.035 lm...

Ngày tải lên: 30/03/2014, 11:20

9 304 0
Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

... NY. 17 Wu Q, Andolfatto P & Haunerland NH (2001) Cloning and sequence of the gene encoding the muscle fatty acid binding protein from the desert locust, Schistocerca gregaria. Insect Biochem Mol ... shown in capital letters, with the coding sequences of each exon underlined and the deduced amino acid sequence indicated below. The nucleo- tide positions in the g...

Ngày tải lên: 16/03/2014, 00:20

11 402 0
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

... aggregation and assisting in proper folding [2]. The other class of proteins includes enzymes that catalyze speci c steps of protein folding. This group of proteins includes disulfide isomerases, which catalyze ... discussion Detection of a protein with increased cellular content at a low temperature Cellular contents of the proteins in the bacterial cells are often...

Ngày tải lên: 16/03/2014, 16:20

10 436 0
w