Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx

Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx

Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx

... 11, 127–128. Ó FEBS 2004 Trp58 mutants at subsite )2 of human salivary a-amylase (Eur. J. Biochem. 271) 2529 Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity Narayanan ... mediate the information flow during substrate binding and catalysis [13]. The conformation adopted by the loop structure in W58L is another s...

Ngày tải lên: 23/03/2014, 12:20

13 396 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... intermediate, which is essen- tial for their catalysis [33,34]. A His residue in an RHGXRXP motif that is highly conserved among APases has been proposed to form this intermediate [34]. His301 in the ... phosphate. One unit (U) of phosphatase activity is defined as the amount of enzyme resulting in the production of 1 lmol phosphate per min at 37 °C. The specific activity is d...

Ngày tải lên: 19/02/2014, 18:20

10 561 1
Báo cáo khoa học: Caspase-8- and JNK-dependent AP-1 activation is required for Fas ligand-induced IL-8 production ppt

Báo cáo khoa học: Caspase-8- and JNK-dependent AP-1 activation is required for Fas ligand-induced IL-8 production ppt

... (Z-YVAD-fmk), suggesting that the catalytic activity of caspase-8 was important for FasL- induced JNK activation. Discussion In this study, we demonstrated that AP-1 activation is required for optimal IL-8 ... apoptosis after FasL treatment. Using this system, we recently discovered that caspase-8-mediated cell-autonomous NF-jB activation is crucial for this response [10]. In addi...

Ngày tải lên: 07/03/2014, 09:20

9 362 0
Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf

Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf

... PAGE (Fig. 2). The ABTS activity for pool 1 (430 nkatÆmg )1 ) was consistently slightly lower than that for pool 2 (520 nkatÆmg )1 ). Pool 2 was therefore used for charac- terization. Table 1 presents ... site was dis- turbed. The His140, which is coordinated to the T3 copper, is slightly rotated as compared with the native enzyme, and it forms a hydrogen bond with a water molecu...

Ngày tải lên: 16/03/2014, 00:20

16 453 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx

Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx

... have shown that the ATP-binding domain of HSP70 is essential for its anti-apoptotic role. For example, deletional analysis demonstrated that the ATP-binding domain is essential for inhibiting the ... Furthermore, the ATP-binding domain of HSP70 is critical for sequester- ing AIF in the cytosol [29]. In the present study, we demonstrated that the ATP-binding domain of HSP70 was...

Ngày tải lên: 16/03/2014, 01:20

10 727 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx

Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx

... J. Biochem. 270) 151 therefore, it is still ambiguous whether the regions, especially the region responsible for dimer formation and that for client binding, exist at distinct sites of the C-terminal ... This issue is now under investigation in our laboratory. Acknowledgements We greatly appreciate Drs D. Ladant (Pasteur Institute, Paris, France) and L. Selig (Hybrigenics S.A., Pari...

Ngày tải lên: 23/03/2014, 20:22

9 365 0
Báo cáo khoa học: A cocaine insensitive chimeric insect serotonin transporter reveals domains critical for cocaine interaction ppt

Báo cáo khoa học: A cocaine insensitive chimeric insect serotonin transporter reveals domains critical for cocaine interaction ppt

... for generating chimeras. Restriction site Primers KpnI5¢-TTAGAAGGTACCCCATTGTATGGGATC (forward) NdeI5¢-ACGCATATGTTACCAGAATGGAGGCGGT (forward) 5¢-CGCCATATGTAGGGGAATCGCCACACGT (reverse) NsiI5¢-ATAATGCATCACTCTCTGGAAACGGATC (forward) BglII ... 5¢-TGGTCATCACCTGCTACTTTGGATCCCTGGTCACCCTGAC (forward) 5¢-GTCAGGGTGACCAGGGATCCAAAGTAGCAGGTGATGACCA (reverse) F515V F to V 5¢-GTCGCTGTGTCTTGGGTCTATGGCATCACT...

Ngày tải lên: 23/03/2014, 21:21

11 408 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... indicates that Cdc45 is relatively stable in proliferating human cells. Indeed, the stabilizing residue methionine is found at the N-terminus of the human Cdc45 protein (NCBI NP 003495). This is ... proteins in human cells, supporting the concept that origin binding of Cdc45 is rate limiting for replication initiation. We also show that the Cdc45 protein level is consisten...

Ngày tải lên: 19/02/2014, 00:20

16 505 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG pCR2.1 ⁄ PDIP46(2) ⁄ SKAR(b) CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG pHybLex ⁄ Zeo-ER GCGGAATTCTCTCACACCATTTTGCTGGT GCGCTCGAGTTATTTCCCAGCCTGTTGGGCCTG pQE30 ... activation of HIS3 and lacZ Table 1. Primer sets for construction of plasmids used in this study. Plasmid Pri...

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... differen- tiation arrest in mice [35]. These results indicate that heme is essential for differentiation of erythroid cells. In this context, our preliminary data suggest that treatment for 48 h ... and evidence for their separate regulation. J Biochem (Tokyo) 113, 214–218. 10 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S (1994) Identification of a cis-acting element that...

Ngày tải lên: 19/02/2014, 06:20

12 622 0
w