Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx
... All of these results show that various elements and features of the t peptide contribute to determine the cellular fate of the protein and deserve further investigations. It is highly probable that ... less extended C-terminal segments of the t peptide, in Torpedo AChE T subunits, to determine the structural basis of the character- istic properti...
Ngày tải lên: 23/03/2014, 12:20
... yeast extract as the untagged protein, indicating that the tag was not interfering with the protein activity. The tagged protein was purified and then used for further analysis. In the reductive ... used: 5¢-gaattcagaatg gcctccaagacgta-3¢ and 5¢-gaattcttattcctcctctggccaaa-3¢. The PCR product was cloned, similar to gld1, first in a TOPO vector and then in the expression vec...
Ngày tải lên: 19/02/2014, 06:20
... 5¢-AGAAGCCATT GCTGAGCAATTTTTGTTC-3¢ (underlining i ndicates t he Bpu1102I restriction site) and t he reverse primer 5¢-AAA AAGCTTGCACTAATTTTATTT GAC-3¢ (underliningindicates the HindIII restriction site and stop ... 5¢-ATGACTATTTCTTCTGCACAT CCAGAGACAGAAC-3¢ con tains the initiation codon, while the reverse primer 5¢-CTTTCTGCAGACTCA TTCGCTGATATATATTC-3¢ linked a PstI restriction...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "Completing on the partial basis parses of ill-formed sentences of discourse information" docx
... date collocation patterns: "use -(on)- desktop" and '%lder -(on)- desktop." such as the 1st sentence to the 20th, the 51st to the 70th, and the 701st to the 720th. Thus, ... analyses of other sentences in the same text, thus, attempting to generate the analy- sis most appropriate to the discourse. The results of our experiments show the...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: Mutations in the C-terminal domain of ALSV (Avian Leukemia and Sarcoma Viruses) integrase alter the concerted DNA integration process in vitro pot
... domain mutants. Letters above indicate the mutation: the first letter is the original residue, the number its position in the protein, and the second letter the residue that it was substituted into. ... residue of strand b4¢. The V260E mutation could prevent the formation of this strand as glutamate acts as a strand breaker [61]. Altogether, these data suggest a stron...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... unaware that the study was being conducted. Ethical approval was not sought, because at the time audits were not within the remit of the local ethics committee. Prior to introduction of CPOE, ... al. R519 prescribed. These intercepted errors were not administered to the patient because either the pharmacist intercepted the prescription before administration or the nurse...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt
... (protists). On the other hand, it is not possible to exclude that in the future some new sequences of hcHAT-like proteins of nonmetazoan origin may become available that together with the results ... rooting the tree that is on the branch leading to the enzymes originating from non-Metazoa (the eventual outgroup). It is worth mentioning, however, that if the evolu-...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt
... or tripalmitin as standards. The experimental data were normalized to the intensity of the incident beam and corrected for the detec- tor response, the buffer scattering was substracted, and the statistical ... constants, determined at about 10-fold lower protein concentration than the measurements of inactivation, show the same trends with respect to the effects of...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... identified the multiple transcription initi- ation sites of the HO-2 gene and confirmed that the HO-2 gene promoter is juxtaposed to the HSCARG gene in the opposite direction. Thus, the HO-2 gene and the ... Prior to the functional analysis of the HO-2 gene promoter, we determined its transcription initiation site by 5¢-RACE, and this indicated that transcription...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khóa học: Mutations in the hydrophobic core and in the protein–RNA interface affect the packing and stability of icosahedral viruses doc
... (WT) bacteriophage and ts mutants. Two mutations that appear to lead to the formation of cavities, one in the hydrophobic core (M88V) and the other in the protein–RNA interaction (T4 5S), decrease the ... assembling the whole particle. It is also interest- ing that the mutants had a ts phenotype, which means a high sensitivity to both high and low temperatures. The...
Ngày tải lên: 19/02/2014, 12:20