Báo cáo khóa học: Acyl-CoA dehydrogenases and acyl-CoA oxidases Structural basis for mechanistic similarities and differences pot

... (Eur. J. Biochem. 271) 493 MINIREVIEW Acyl-CoA dehydrogenases and acyl-CoA oxidases Structural basis for mechanistic similarities and differences Jung-Ja P. Kim 1 and Retsu Miura 2 1 Department of ... Identification and expression of the SOS response, aidB-like, gene in the marine sponge Geodia cydo- nium: implication for the phylogenetic relationships of metazoan...

Ngày tải lên: 23/03/2014, 12:20

... reactions are essential for formation of the cornified envelope, which consists of cross-linked structural proteins. Two main transglutamin- ases isoforms, epidermal-type (TGase 3) and keratinocyte-type ... extracellular matrix forma- tion and wound healing, respectively [3–6]. TGase 1 and TGase 3 have been reported to contribute to the formation of the epidermis by cross-linking st...

Ngày tải lên: 29/03/2014, 21:20

... achieves the best performing estimators in all of the tasks, and AP achieves almost as well and requires much less training time. L 1 (Lasso) regularization also per- forms well and leads to sparser ... of parse re-ranking and LM adaptation, and found that on both tasks it leads to a significant improvement in performance for the L 2 -regularied ME estimator but not for...

Ngày tải lên: 08/03/2014, 02:21

... Jonathan Weese, and Omar F. Zaidan Center for Language and Speech Processing, Johns Hopkins University † Computational Linguistics and Information Processing Lab, University of Maryland + Human Language ... leads to a large number of scripts for format conversion and to facilitate interaction between the components, re- sulting in untenable and non-portable projects, and hinde...

Ngày tải lên: 17/03/2014, 02:20

... to SP1 and dis- plays lower affinity for NFjB-L and still much lower for TATA-L. The NFjB-based complex preferentially binds to NFjB-L and displays lower but similar affinity for SP1 and for TATA-L. Tumour ... ON-GPBP-F1 and ON-GPBP-R1 for GPBP; and ON-hGAPDH-F2 and ON-hGAPDH-R2 for GAPDH. Cell culture and transient gene expression assays Cells were grown in Dulbecco...

Ngày tải lên: 30/03/2014, 20:20

... ‘none’, and the mass error tolerances for precursor and fragment ions were typically set to 0.15 u for qTOF MS ⁄ MS and 50 p.p.m. and 1 u, respectively, for MALDI-TOF ⁄ TOF MS data. The formation ... P 1 ¢ for MMP-12 in this and another study [43], the studies on elastin have not identified Lys at P 1 ¢. The reasons for this lie in signifi- cant structural differences be...

Ngày tải lên: 16/02/2014, 14:20

... these two chromosomal systems and pem ⁄ parD and, together with structural information on free or bound toxin and antitoxin pro- teins obtained by X-ray crystallography and NMR spectroscopy (see ... dominated by eight b-strands and a twelve residue C-terminal a-helix. The b-strands are arranged as a sheet formed by a five-stranded twisted antiparal- lel sheet plus a small three-stra...

Ngày tải lên: 18/02/2014, 04:20

... divided into two subdomains: HR-A and HR-B. The amino-terminal HR-A has the potential to form trimers independently of HR-B, and the carboxy-terminal HR-B can form large oligomers [7]. Keywords chromatin; ... status and ⁄ or the affinity of each DBD for nGAAn changes under stress conditions is not known. The activation domains at the amino- and carboxy-termini are required for the...

Ngày tải lên: 18/02/2014, 04:20

... gene family and the circadian clock Remco Nagel 1 , Linda Clijsters 1 and Reuven Agami 1,2 1 Division of Gene Regulation, The Netherlands Cancer Institute, Amsterdam, The Netherlands 2 Center for Biomedical ... sites for miR-192 or miR-194. Whereas the Per1 3¢UTR contains one predicted target site for miR-194, Per2 has a site for miR-192 as well as miR-194, and Per3 harbours one...

Ngày tải lên: 18/02/2014, 06:20

... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ ... to Dr Shaker Chuck Farah and Dr Carla Columbano de Oliveira for their helpful comments and Dr Marvin Wickens for providing t...

Ngày tải lên: 18/02/2014, 06:20