Báo cáo khóa học: Acyl-CoA dehydrogenases A mechanistic overview ppt

Tài liệu Báo cáo khoa học: "PROJECT APRIL -- A PROGRESS REPORT" ppt

Tài liệu Báo cáo khoa học: "PROJECT APRIL -- A PROGRESS REPORT" ppt

... non-terminal alphabet is associated with a transition network, each arc of which is assigned a probability as well as a (non-terminal or terminal) label: the probability estimate for a node labelled ... by mathematical treaunents that have so far appeared" and our application does in fact take several liberties with the "pure" algorithm as set out in the literatu...
Ngày tải lên : 21/02/2014, 20:20
  • 9
  • 368
  • 0
Báo cáo khóa học: Acyl-CoA dehydrogenases A mechanistic overview ppt

Báo cáo khóa học: Acyl-CoA dehydrogenases A mechanistic overview ppt

... Okamura-Ikeda, K. & Tanaka, K. (1985) Mechanism of action of short-chain, medium-chain, and long- chain acyl-CoA dehydrogenases. Direct evidence for carbanion formation as an intermediate ... of the accompanying paper on the three-dimensional properties of acyl-CoA dehydrogenases. Keywords:fattyacidb-oxidation; acyl-CoA dehydrogenase; acyl-CoA oxidase a, b-dehydrogenation; mec...
Ngày tải lên : 23/03/2014, 12:20
  • 15
  • 422
  • 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... were classified as those causing an increase in patient monitoring, a change in vital signs but without associated harm or a need for treatment or increased length of stay. Major errors were categorised ... director, according to an adapted scale [9-11]. Minor errors were classified as those causing no harm or an increase in patient monitoring with no change in vital signs and no harm not...
Ngày tải lên : 25/10/2012, 10:39
  • 6
  • 526
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... jbc.M110.177246. 24 Doi H, Okamura K, Bauer PO, Furukawa Y, Shimizu H, Kurosawa M, Machida Y, Miyazaki H, Mitsui K, Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggreg...
Ngày tải lên : 14/02/2014, 19:20
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene ... FEBS 23 Chang CK (1994) Heme d 1 and other heme cofactors from bacteria. Ciba Found Symp 180, 228–238. 24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar MJ, Anazawa H, Harms N, Oltma...
Ngày tải lên : 15/02/2014, 01:20
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... red). Table 1. Average distances between CA atoms of the stefins and catalytic residues of cysteine proteases. Distance calculated d (A ˚ ) Papain–stefin B 23.93 Cathepsin H–stefin A 23.36 ± 0.23 Cathepsin ... Biochemistry and Molecular and Structural Biology, Jozef Stefan Institute, Jamova 39, SI-1000 Ljubljana, Slovenia Fax: +386 1 477 3984 Tel: +386 1 477 3215 E-mail: dusan.turk@ijs.si Dat...
Ngày tải lên : 18/02/2014, 04:20
  • 8
  • 632
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x...
Ngày tải lên : 18/02/2014, 14:20
  • 16
  • 646
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATC CAAGAACTGTGTATGTCTG-3¢. The 1.6-kbp full- length Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and ......
Ngày tải lên : 18/02/2014, 16:20
  • 14
  • 499
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotak...
Ngày tải lên : 18/02/2014, 17:20
  • 11
  • 873
  • 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from human placenta. J Biol Chem 253, 1766–1772. 22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... plasmon resonance. Anal Biochem 305, 1–9. 16 Wuerges J, Garau G, Geremia S, Fedosov SN, Petersen TE & Randaccio L (2006) Structural basis for mamma- lian vitamin B 12 transport by transcoba...
Ngày tải lên : 19/02/2014, 05:20
  • 12
  • 603
  • 0