Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc
... protease systems: calpain- induced cath- epsin release, cathepsin-mediated caspase activation and caspase-mediated calpastatin degradation leading to enhancement of calpain activity. Calpains and ... translocation of calpain in the intermembrane space and AIF cleavage (tAIF) and release; (3) calpain- mediated Bcl-xL inactivation and cytochrome c release; (4) calpain- mediated p53...
Ngày tải lên: 23/03/2014, 10:21
... examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles from the experimental joints was examined to assess any macro- scopic damage ... proteasome inhibition enhanced TRAIL-induced apoptosis in canine chondrocytes, we examined caspase-8 activation and death receptor-5 (DR-5) and TRAIL protein A B Fig. 1. Evaluation of art...
Ngày tải lên: 18/02/2014, 14:20
... Take, M., Tsutsui, J., Obama, H., Ozawa, M., Nakayama, T., Maruyama, I., Arima, T. & Muramatsu, T. (1994) Identification of nucleolin as a binding protein for midkine (MK) and heparin- binding ... raised against hLf. After partial fixation in 0.25% paraformaldehyde, the co-aggregation of hLf with nucleolin was investigated using the murine mAb D3 against human nucleolin [23]. (B) Th...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... Differ- ential involvement of calmodulin-dependent protein kinase II-activated AP-1 and c-Jun N-terminal kinase- activated EGR-1 signaling pathway in tumor necrosis factor-ƒ and lipopolysaccharide-induced ... cuticles of most insect larvae have a variety of melanin patterns that function in the insects’ interactions with their biotic and abiotic environ- ments. Larvae of the arm...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... mori: amino acid sequence and dimeric structure. Agric Biol Chem 55, 73–86. 6 Kawakami A, Kataoka H, Oka T, Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki ... N-termini and within an adjacent 29-amino-acid region referred to as the MEF2 domain. The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an important role...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt
... si-NF-jB1, an 70 bp double-stranded si-NF-jB1 was obtained by annealing using two single-strands NF- jB1-Top, 5¢-GATCCCGCCTGAACAAATGTTTCATTTG GTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTG GAAA-3¢; and NF-jB1-Bot, ... NF-jB1-Bot, 5¢-AGCTTTTCCAAAAAA GCCTGAACAAATGTTTCATTTGGCTCTTGACCAAA TGAAACATTTGTTCAGGCGG-3¢, and then cloned into pSilencer 2.1 neo vector (Ambion). Annealing was per- formed as: 95 °C fo...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion docx
... leak in mammalian AQP1, which may explain why 99% of all AQPs carry Asn at the NPA sites. Results Natural replacement of Asn in the NPA motifs is rare Inspection of the b-proteobacterial genome data ... cloning and mutational analysis of a novel aquaglyceroporin carrying one SPA motif instead of the NPA motif from Burkholderia cenocepacia, an epidemic pathogen of cystic fibro...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt
... the trends in the reading time data. All other things be- ing equal, we might expect a reading time penalty for a garden-path region when the size of the prob- ability decrease at the disambiguating ... researchers have assumed, following standard linguistic the- ory, that a formally adequate account of recur- sive syntactic structure is an essential component of any model of...
Ngày tải lên: 17/03/2014, 04:20
Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc
... -FNR 1 (AB035644): forward primer, 5¢-ACAACACAAAATGTCAGCTGC AAAA-3¢; reverse primer, 5¢-AAGGCCAAGAAGGAGTC CAAGAAG-3¢; L-FNR 2 (AB035645): forward primer, 5¢-TTGCTTGAGCTGAACAATACAATGAA-3¢; reverse primer, ... from xylem, and vice versa. Glx (glutamine and glutamate: five carbon amide and amino acid) and Asx (asparagine and aspartate: four carbon amide and amino acid) were found to be the main n...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...
Ngày tải lên: 14/02/2014, 14:20