Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc
Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc
... protease systems: calpain- induced cath-
epsin release, cathepsin-mediated caspase activation
and caspase-mediated calpastatin degradation leading
to enhancement of calpain activity.
Calpains and ... translocation of calpain in the
intermembrane space and AIF cleavage
(tAIF) and release; (3) calpain- mediated
Bcl-xL inactivation and cytochrome c
release; (4) calpain- mediated p53...
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf
... examination of the
articular cartilage after experimentally induced
OA
Articular cartilage of the femoral condyles from the
experimental joints was examined to assess any macro-
scopic damage ... proteasome
inhibition enhanced TRAIL-induced apoptosis in
canine chondrocytes, we examined caspase-8 activation
and death receptor-5 (DR-5) and TRAIL protein
A
B
Fig. 1. Evaluation of art...
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx
... Take, M., Tsutsui, J., Obama, H., Ozawa, M., Nakayama, T.,
Maruyama, I., Arima, T. & Muramatsu, T. (1994) Identification
of nucleolin as a binding protein for midkine (MK) and heparin-
binding ... raised against hLf. After
partial fixation in 0.25% paraformaldehyde, the co-aggregation of hLf with nucleolin was investigated using the murine mAb D3 against human
nucleolin [23]. (B) Th...
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... Differ-
ential involvement of calmodulin-dependent protein
kinase II-activated AP-1 and c-Jun N-terminal kinase-
activated EGR-1 signaling pathway in tumor necrosis
factor-ƒ and lipopolysaccharide-induced ... cuticles of most insect larvae have a variety of melanin patterns that
function in the insects’ interactions with their biotic and abiotic environ-
ments. Larvae of the arm...
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... mori: amino acid sequence and
dimeric structure. Agric Biol Chem 55, 73–86.
6 Kawakami A, Kataoka H, Oka T, Mizoguchi A,
Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa
H, Suzuki A & Ishizaki ... N-termini and within an adjacent 29-amino-acid
region referred to as the MEF2 domain. The MADS
box is essential for DNA binding and dimerization,
and the MEF2 domain plays an important role...
Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt
... si-NF-jB1, an 70 bp double-stranded si-NF-jB1
was obtained by annealing using two single-strands NF-
jB1-Top, 5¢-GATCCCGCCTGAACAAATGTTTCATTTG
GTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTG
GAAA-3¢; and NF-jB1-Bot, ... NF-jB1-Bot, 5¢-AGCTTTTCCAAAAAA
GCCTGAACAAATGTTTCATTTGGCTCTTGACCAAA
TGAAACATTTGTTCAGGCGG-3¢, and then cloned into
pSilencer 2.1 neo vector (Ambion). Annealing was per-
formed as: 95 °C fo...
Báo cáo khoa học: Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion docx
... leak
in mammalian AQP1, which may explain why 99% of
all AQPs carry Asn at the NPA sites.
Results
Natural replacement of Asn in the NPA motifs is
rare
Inspection of the b-proteobacterial genome data ... cloning and mutational analysis of a novel
aquaglyceroporin carrying one SPA motif instead of the NPA motif from
Burkholderia cenocepacia, an epidemic pathogen of cystic fibro...
Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt
... the
trends in the reading time data. All other things be-
ing equal, we might expect a reading time penalty
for a garden-path region when the size of the prob-
ability decrease at the disambiguating ... researchers
have assumed, following standard linguistic the-
ory, that a formally adequate account of recur-
sive syntactic structure is an essential component
of any model of...
Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc
... -FNR 1 (AB035644):
forward primer, 5¢-ACAACACAAAATGTCAGCTGC
AAAA-3¢; reverse primer, 5¢-AAGGCCAAGAAGGAGTC
CAAGAAG-3¢; L-FNR 2 (AB035645): forward primer,
5¢-TTGCTTGAGCTGAACAATACAATGAA-3¢; reverse
primer, ... from xylem, and vice
versa. Glx (glutamine and glutamate: five carbon
amide and amino acid) and Asx (asparagine and
aspartate: four carbon amide and amino acid) were
found to be the main n...
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... AYRAAYTCRWRBCCYTTCCA
RPE6 5a- Fwd
NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC
RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG
RPE65c-Fwd
NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC
RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG
RPE6 5a ... CCTTTGACATCGCAAGTGGATCA
RPE65c GSP-Fwd
NM_001113653 TTGAGGTGACAGACAATTGCCT
RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG
RPE6 5a- His-Fwd
NM_200751 GCGGCCGCCACCATGCA...
Từ khóa: