Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc

Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc

Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc

... protease systems: calpain- induced cath- epsin release, cathepsin-mediated caspase activation and caspase-mediated calpastatin degradation leading to enhancement of calpain activity. Calpains and ... translocation of calpain in the intermembrane space and AIF cleavage (tAIF) and release; (3) calpain- mediated Bcl-xL inactivation and cytochrome c release; (4) calpain- mediated p53...

Ngày tải lên: 23/03/2014, 10:21

7 341 0
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

... examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles from the experimental joints was examined to assess any macro- scopic damage ... proteasome inhibition enhanced TRAIL-induced apoptosis in canine chondrocytes, we examined caspase-8 activation and death receptor-5 (DR-5) and TRAIL protein A B Fig. 1. Evaluation of art...

Ngày tải lên: 18/02/2014, 14:20

11 461 0
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

... Take, M., Tsutsui, J., Obama, H., Ozawa, M., Nakayama, T., Maruyama, I., Arima, T. & Muramatsu, T. (1994) Identification of nucleolin as a binding protein for midkine (MK) and heparin- binding ... raised against hLf. After partial fixation in 0.25% paraformaldehyde, the co-aggregation of hLf with nucleolin was investigated using the murine mAb D3 against human nucleolin [23]. (B) Th...

Ngày tải lên: 07/03/2014, 15:20

15 509 0
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx

Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx

... Differ- ential involvement of calmodulin-dependent protein kinase II-activated AP-1 and c-Jun N-terminal kinase- activated EGR-1 signaling pathway in tumor necrosis factor-ƒ and lipopolysaccharide-induced ... cuticles of most insect larvae have a variety of melanin patterns that function in the insects’ interactions with their biotic and abiotic environ- ments. Larvae of the arm...

Ngày tải lên: 16/03/2014, 11:20

10 440 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

... mori: amino acid sequence and dimeric structure. Agric Biol Chem 55, 73–86. 6 Kawakami A, Kataoka H, Oka T, Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki ... N-termini and within an adjacent 29-amino-acid region referred to as the MEF2 domain. The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an important role...

Ngày tải lên: 30/03/2014, 20:20

10 437 0
Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

... si-NF-jB1, an  70 bp double-stranded si-NF-jB1 was obtained by annealing using two single-strands NF- jB1-Top, 5¢-GATCCCGCCTGAACAAATGTTTCATTTG GTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTG GAAA-3¢; and NF-jB1-Bot, ... NF-jB1-Bot, 5¢-AGCTTTTCCAAAAAA GCCTGAACAAATGTTTCATTTGGCTCTTGACCAAA TGAAACATTTGTTCAGGCGG-3¢, and then cloned into pSilencer 2.1 neo vector (Ambion). Annealing was per- formed as: 95 °C fo...

Ngày tải lên: 07/03/2014, 00:20

10 413 0
Báo cáo khoa học: Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion docx

Báo cáo khoa học: Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion docx

... leak in mammalian AQP1, which may explain why 99% of all AQPs carry Asn at the NPA sites. Results Natural replacement of Asn in the NPA motifs is rare Inspection of the b-proteobacterial genome data ... cloning and mutational analysis of a novel aquaglyceroporin carrying one SPA motif instead of the NPA motif from Burkholderia cenocepacia, an epidemic pathogen of cystic fibro...

Ngày tải lên: 15/03/2014, 00:20

9 341 0
Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt

Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt

... the trends in the reading time data. All other things be- ing equal, we might expect a reading time penalty for a garden-path region when the size of the prob- ability decrease at the disambiguating ... researchers have assumed, following standard linguistic the- ory, that a formally adequate account of recur- sive syntactic structure is an essential component of any model of...

Ngày tải lên: 17/03/2014, 04:20

6 344 0
Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc

Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc

... -FNR 1 (AB035644): forward primer, 5¢-ACAACACAAAATGTCAGCTGC AAAA-3¢; reverse primer, 5¢-AAGGCCAAGAAGGAGTC CAAGAAG-3¢; L-FNR 2 (AB035645): forward primer, 5¢-TTGCTTGAGCTGAACAATACAATGAA-3¢; reverse primer, ... from xylem, and vice versa. Glx (glutamine and glutamate: five carbon amide and amino acid) and Asx (asparagine and aspartate: four carbon amide and amino acid) were found to be the main n...

Ngày tải lên: 18/02/2014, 18:20

14 567 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Từ khóa:
w