Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf
Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf
... Authors Journal compilation ª 2006 FEBS Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure Andrea P. Rojas-Gil1, Panos G. Ziros2, Leonor Diaz2, ... Takahashi Y, Shirono H, Arisaka O, Takahashi K,Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T& Chihara K (1997) Biologically inactive growth hor-mone caused by an amino acid substitution. ... ReverseTranscription System (Thermoscrip RT, Invitrogen).Human GHR was amplified from cDNA with primersACACTCAAGAATGGACTCAAG and TGTAAATTGGCTCATCTGAG under the following conditions: denatura-tion at...
- 13
- 323
- 0
Báo cáo khoa học: ˚ cDNA cloning and 1.75 A crystal structure determination of PPL2, an endochitinase and N-acetylglucosaminebinding hemagglutinin from Parkia platycephala seeds potx
... Biologia, Universidade Estadual de Campinas (UNICAMP), Campinas, SP, Brazil8 Faculdade de Medicina, Universidade Federal do Ceara´, Sobral, Brazil9 Laboratorio de Bioquı´mica Marinha, Departamento ... Pastuszak I, Drake R & Elbein AD (1996) KidneyN-acetylgalactosamine (GalNAc)-1-phosphate kinase, a new pathway of GalNAc activation. J Biol Chem 271,20776–20782.47 Ainouz IL, Sampaio AH, ... Debray6, Juan J. Calvete5and Libia Sanz51 BioMol-Laboratory, Departamento de Bioquı´mica e Biologia Molecular, Universidade Federal do Ceara´, Fortaleza, Ceara´, Brazil2 Departamento...
- 13
- 487
- 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CACGCAGCTCATTGTAGAAGG-3¢. Another primer pairused for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCCACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAATACATCA-3¢.Western blot assayThe cells ... pcDNA3.1-GST-Nur77plasmid. pSilencer-shNur77 was prepared by overlappingstrategy with primers 5¢-gacGGATCCgcagtccagccatgctcctttcaagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATCGATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-CTAATCTCTTCCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/-182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCTCGTGATCTGCCCA-3¢ for Lst-595.pcDNA3.1-Nur77 expression plasmid...
- 14
- 397
- 0
Báo cáo khoa học: Escherichia coli cyclophilin B binds a highly distorted form of trans-prolyl peptide isomer doc
... the Ala-cis-Pro amidebond.In the case of CyPB in complexes with Suc-Ala-trans-Pro-Ala-pNA and Ac-Ala-Ala-trans-Pro-Ala-AMC, the largedistortion in the orientation of Ala1 and Ala2 of Ala-Prowith ... of Agriculture and Technology, Tokyo, Japan [5]. PCR wascarried out using a 32-mer primer of 5¢-AAAAAGAATTCATCGATATGTTCAAATCGACC-3¢ with EcoRIadded at the 5¢ end of ClaI, a 23-mer primer of 3¢-CGAGACGGCATTCCTAGGTTTTT-5¢, ... (Suc-Ala-Pro-Ala-pNA), and w ith a tetrapeptide, acetyl-Ala-Ala-Pro-Ala-amidomethylcouma-rin (Ac-Ala-Ala-Pro-Ala-AMC), and w e found highlydistorted trans-peptides. We carried out comparisons of these...
- 10
- 244
- 0
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: therapeutic aspects of vascular endothelial growth factor doc
... enhancement of vascular permeability and inflammation. ArteriosclerThromb Vasc Biol 26, 2019–2026.9 Takahashi H, Hattori S, Iwamatsu A, Takizawa H &Shibuya M (2004) A novel snake venom vascular ... S, Sakurai Y, Ito M, Shitara K,Nakahata T & Shibuya M (2001) Vascular endothelial growth factor receptor-1 (Flt-1) is a novel cell surfacemarker for the lineage of monocytes–macrophages ... survival rate and total sur-vival rate of cancer patients via at least two mecha-nisms, (a) blocking of tumor angiogenesis and (b)normalization of tumor vessels, although some adverseeffects have...
- 8
- 569
- 0
Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc
... Nag2_term_fw_ApaI TCTTGGGCCCTGATACAGACACD nag2_term-rv_ApaI AGTTTGGGCCCTGCGAGTTTGE nag2-prom-fwnest TGGCATACAGACTGGGCGF nag2-term-rvnest AGAACTCGGCTCCATAGGCG Nag2-cds-fw TTGAAGAAGAGCTGCGAGH hph-fw ... the Dnag1strain, and that almost no growth of the Dnag1Dnag2strains occurred at all. Extracellular NAGase activities of the Dnag2 strains, normalized to the amount of bio-mass, were similar to ... Biolog analysis (see above). A microscopical analysis of hyphal growth and branchingpatterns did also not reveal any differences among theanalysed strains (Fig. S3B), indicating that the NAG-ases...
- 12
- 456
- 0
Báo cáo khoa học: Methylcitrate synthase from Aspergillus fumigatus Propionyl-CoA affects polyketide synthesis, growth and morphology of conidia ppt
... activation of acetate is always higher in A. nidulans than that forthe activation of propionate (Table 5). In A. fumigatuspropionyl-CoA synthetase activity exceeds that of ace-tyl-CoA synthetase, ... study. Half and full NotIrestriction sites are shown in bold.Name of oligonucleotide Sequence 5¢fi3¢cDNAmcsAAf_up GAC CAT CCC TTG ATA GCA TCcDNAmcsAAf_down GAT ATC ACA GGC TCA CAG GNotMcsAAf_up ... The same amount of pyruvatewas found, when the former strain (A. fumigatus) wasTable 2. Comparison of properties of methylcitrate synthases from A. fumigatus and A. nidulans.ParameterMcsA A. ...
- 16
- 325
- 0
Báo cáo khoa học: Aldo-keto reductase from Helicobacter pylori – role in adaptation to growth at acid pH doc
... beregarded as an approximation, as higher concentra-tions of sodium valproate appeared to cause the initialrate behaviour to depart from simple Michaelis–Menten kinetics. Variation of the apparent ... Brilliant Blue, and a proteinspecies with an apparent molecular mass of 39 kDa(Fig. 1) was evident; this molecular mass comparesfavourably with that of 37 kDa obtained from theamino acid sequence. ... pathogenesis of gastric disease. Previous studies in thislaboratory examined a cinnamyl alcohol dehydrogenase that was capable of detoxifying a range of aromatic aldehydes. In the present work, we haveextended...
- 10
- 316
- 0
Tài liệu Báo cáo khoa học: Chromatin under mechanical stress: from single 30 nm fibers to single nucleosomes pdf
... summarize the available data and their impacton our knowledge of both nucleosomal structure and the dynamics of nucleosome and chromatin fiber assembly and organization.AbbreviationsACF, ATP-dependent ... behavior of a 36 nucleosome long array reconsti-tuted on the tandem repeat of 5s DNA under torsionalstress [70]. The acquired data allowed the determina-tion of several elastic parameters of ... graduallydecreased and was finally halted at forces above 10pN. A similar fast rate of nucleosome assembly wasalso observed in experiments where DNA wasstretched by hydrodynamic shear forces and...
- 13
- 586
- 0
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... of the Y chromosome of themedaka, Oryzias latipes. Proc Natl Acad Sci USA 99,11778–11783.9 Matsuda M, Nagahama Y, Shinomiya A, Sato T,Matsuda C, Kobayashi T, Morrey CE, Shibata N,Asakawa ... Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, HamaguchiS, Sakaizumi M & Nagahama Y (2007) DMY geneinduces male development in genetically female (XX)medaka fish. Proc Natl Acad Sci USA 104, ... &Sakaizumi M (2006) Wild-derived XY sex-reversalmutants in the medaka, Oryzias latipes. Genetics 173,2083–2090.12 Otake H, Masuyama H, Mashima Y, Shinomiya A, Myosho T, Nagahama Y, Matsuda...
- 10
- 860
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM