Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf
Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf
... Authors Journal compilation ª 2006 FEBS Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure Andrea P. Rojas-Gil 1 , Panos G. Ziros 2 , Leonor Diaz 2 , ... Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hor- mone caused...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: ˚ cDNA cloning and 1.75 A crystal structure determination of PPL2, an endochitinase and N-acetylglucosaminebinding hemagglutinin from Parkia platycephala seeds potx
... Biologia, Universidade Estadual de Campinas (UNICAMP), Campinas, SP, Brazil 8 Faculdade de Medicina, Universidade Federal do Ceara ´ , Sobral, Brazil 9 Laboratorio de Bioquı ´ mica Marinha, Departamento ... Pastuszak I, Drake R & Elbein AD (1996) Kidney N-acetylgalactosamine (GalNAc)-1-phosphate kinase, a new pathway of GalNAc activation. J Biol Chem 271, 20776–20782. 47 Ainouz IL, Sa...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢. Another primer pair used for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCC ACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAA TACATCA-3¢. Western blot assay The cells ... pcDNA3.1-GST-Nur77 plasmid. pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Escherichia coli cyclophilin B binds a highly distorted form of trans-prolyl peptide isomer doc
... the Ala-cis-Pro amide bond. In the case of CyPB in complexes with Suc-Ala-trans-Pro- Ala-pNA and Ac-Ala-Ala-trans-Pro-Ala-AMC, the large distortion in the orientation of Ala1 and Ala2 of Ala-Pro with ... of Agriculture and Technology, Tokyo, Japan [5]. PCR was carried out using a 32-mer primer of 5¢-AAAAAGAAT TCATCGATATGTTCAAATCGACC-3¢ with EcoRI added at the 5¢ end of ClaI, a...
Ngày tải lên: 30/03/2014, 15:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: therapeutic aspects of vascular endothelial growth factor doc
... enhancement of vascular permeability and inflammation. Arterioscler Thromb Vasc Biol 26, 2019–2026. 9 Takahashi H, Hattori S, Iwamatsu A, Takizawa H & Shibuya M (2004) A novel snake venom vascular ... S, Sakurai Y, Ito M, Shitara K, Nakahata T & Shibuya M (2001) Vascular endothelial growth factor receptor-1 (Flt-1) is a novel cell surface marker for the lineage of monocy...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc
... Nag2_term_fw_ApaI TCTTGGGCCCTGATACAGACAC D nag2_term-rv_ApaI AGTTTGGGCCCTGCGAGTTTG E nag2-prom-fwnest TGGCATACAGACTGGGCG F nag2-term-rvnest AGAACTCGGCTCCATAGGC G Nag2-cds-fw TTGAAGAAGAGCTGCGAG H hph-fw ... the Dnag1 strain, and that almost no growth of the Dnag1Dnag2 strains occurred at all. Extracellular NAGase activities of the Dnag2 strains, normalized to the amount of bio- mass, w...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: Methylcitrate synthase from Aspergillus fumigatus Propionyl-CoA affects polyketide synthesis, growth and morphology of conidia ppt
... activation of acetate is always higher in A. nidulans than that for the activation of propionate (Table 5). In A. fumigatus propionyl-CoA synthetase activity exceeds that of ace- tyl-CoA synthetase, ... study. Half and full NotI restriction sites are shown in bold. Name of oligonucleotide Sequence 5¢fi3¢ cDNAmcsAAf_up GAC CAT CCC TTG ATA GCA TC cDNAmcsAAf_down GAT ATC ACA GGC TCA CAG...
Ngày tải lên: 23/03/2014, 15:20
Báo cáo khoa học: Aldo-keto reductase from Helicobacter pylori – role in adaptation to growth at acid pH doc
... be regarded as an approximation, as higher concentra- tions of sodium valproate appeared to cause the initial rate behaviour to depart from simple Michaelis– Menten kinetics. Variation of the apparent ... Brilliant Blue, and a protein species with an apparent molecular mass of 39 kDa (Fig. 1) was evident; this molecular mass compares favourably with that of 37 kDa obtained from th...
Ngày tải lên: 30/03/2014, 04:20
Tài liệu Báo cáo khoa học: Chromatin under mechanical stress: from single 30 nm fibers to single nucleosomes pdf
... summarize the available data and their impact on our knowledge of both nucleosomal structure and the dynamics of nucleosome and chromatin fiber assembly and organization. Abbreviations ACF, ATP-dependent ... behavior of a 36 nucleosome long array reconsti- tuted on the tandem repeat of 5s DNA under torsional stress [70]. The acquired data allowed the determina- tion of several elas...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... of the Y chromosome of the medaka, Oryzias latipes. Proc Natl Acad Sci USA 99, 11778–11783. 9 Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa ... Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, Hamaguchi S, Sakaizumi M & Nagahama Y (2007) DMY gene induces male development in genetically female (XX) medaka fish. Proc Natl Acad Sci USA...
Ngày tải lên: 14/02/2014, 19:20