Law, Legitimacy and the Rationing of Healthcare A Contextual and Comparative Perspective docx

Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx

Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx

... control The way the knowledge transfer programme was managed also differed between plants. The idea of the central programme management was that, at the least, plants should make yearly plans for each ... Process Management CASE STUDY Transfer of Knowledge and the Role of Motivation 119 ‘Merchandise’ such as printed T-shirts, armbands and baseball caps were distributed...

Ngày tải lên: 24/01/2014, 00:20

12 515 0
Tài liệu Custom, Power and the Power of Rules International Relations and Customary International Law doc

Tài liệu Custom, Power and the Power of Rules International Relations and Customary International Law doc

... context of the rights of their own nationals abroad. The ‘international minimum standard’ The violation of the rights of a national in a foreign State allows the State of nationality to raise the ... (1973). 24 The Act applied to ‘Arctic waters’, which were described as frozen or liquid waters ‘adja- cent to the mainland and islands of the Canadian Arctic w...

Ngày tải lên: 19/02/2014, 06:20

274 2,3K 0
SAVINGS BANKS AND THE DOUBLE BOTTOM-LINE: A profitable and accessible model of finance doc

SAVINGS BANKS AND THE DOUBLE BOTTOM-LINE: A profitable and accessible model of finance doc

... state banks with a specific savings mandate that are common throughout East Asia and some parts of Latin America. Clearly the regional characterisations of these different models are somewhat arbitrary ... financial institutions – there has always been a clear dual mandate to (a) reach a target group not well served by commercial banks but (b) try and make a reasonable profi...

Ngày tải lên: 06/03/2014, 10:20

84 382 0
Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt

Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt

... region of the 1D 1 H-NMR spectra of reduced apo -a- lactalbumin at 37 °C and pH 7.0 in (A) the absence and (B) the presence of a 1 : 1 subunit molar ratio of wild-type aB-crystallin and (C) the presence ... spectra of reduced apo -a- lactalbumin at 37 °C and pH 7.0 in (A) the absence and (B) the presence of a 1 : 1 subunit molar ratio of wild-type aB-cr...

Ngày tải lên: 16/03/2014, 18:20

14 366 0
Food, Nutrition, Physical Activity, and the Prevention of Cancer: a Global Perspective doc

Food, Nutrition, Physical Activity, and the Prevention of Cancer: a Global Perspective doc

... pro- cessing, and preparation shows that salt and salt-preserved foods are probably a cause of stomach cancer, and that foods contaminated with aflatoxins are a cause of liver cancer. Salt is necessary ... fruits pr obably pr otect against cancers of the mouth, larynx, pharynx, oesophagus, and stomach, and that fruits also probably protect against lung cancer; and that...

Ngày tải lên: 22/03/2014, 16:21

537 878 1
Cambridge.University.Press.Gender.Race.and.the.Writing.of.Empire.Public.Discourse.and.the.Boer.War.Sep.1999.pdf

Cambridge.University.Press.Gender.Race.and.the.Writing.of.Empire.Public.Discourse.and.the.Boer.War.Sep.1999.pdf

... discussing British male sexuality as potentially violent. Charges of rape against  Gender, race, and the writing of empire Africans allow rape a status as a violent crime. Stead replaces the rape charge against ... with rape at this stage in the war. But he does associate the British with rape: Within the last few years the Turks and their Kurdish allies have massacr...

Ngày tải lên: 21/09/2012, 10:54

221 932 3
Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

... teaching and learning and the application of games in teaching and learning application of games in teaching and learning vocabulary at pre Intermediate level at vocabulary at pre Intermediate ... research about teaching and learning second language vocabulary learning second language vocabulary 1.5. Advantages of the use games in 1.5. Advantages of the use gam...

Ngày tải lên: 29/01/2014, 14:36

29 1,4K 2
Tài liệu Báo cáo khoa học: Proton transfer in the oxidative half-reaction of pentaerythritol tetranitrate reductase Structure of the reduced enzyme-progesterone complex and the roles of residues Tyr186, His181 and His184 pdf

Tài liệu Báo cáo khoa học: Proton transfer in the oxidative half-reaction of pentaerythritol tetranitrate reductase Structure of the reduced enzyme-progesterone complex and the roles of residues Tyr186, His181 and His184 pdf

... forward primer), 5¢-CAGGTAACCGTGCGCG ACGCAAGCTCAACCAGGTCGAAG-3¢ (H18 1A, reverse primer), 5¢-GTTGAGCTTCACTCTGCGGCGGGTTACC TGCTGCATCAG-3¢ (H184, forward primer) and 5¢-CTG ATGCAGCAGGTAACCCGCCGCAGAGTGAAGCTCA AC-3¢ ... nitro- aromatic ligands and the substrate 2-cyclohexen-1-one. The H18 1A and H18 4A enzymes retain activity in reductive and oxidative half-reactions, and thus do...

Ngày tải lên: 20/02/2014, 02:21

12 604 0
Governing Electronically E-Government and the Reconfiguration of Public Administration, Policy and Power potx

Governing Electronically E-Government and the Reconfiguration of Public Administration, Policy and Power potx

... Families with Children AHIC Australian Health Information Council ANAO Australian National Audit Of ce ATO Australia Taxation Of ce AUSTRAC The Australia Transaction Reports and Analysis Centre B2B ... more readily obtainable. Australia has other advantages in studying e-government. Australia’s national government has been regularly recognised as an early user and innovator of infor...

Ngày tải lên: 06/03/2014, 06:21

284 633 0
w