Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc

... Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging Elke Fordel, Liesbet Thijs, Luc Moens and Sylvia DewildeDepartment of ... the ﬁnding ofincreased hypoxia-inducible factor (HIF)- 1a and up-regulation of Cygb mRNA, and hypothesized thatCygb (and Ngb) may have a vital role in retinal oxy-gen homeostasis, enabling the ... H2O2levels. For brain and eyes,there was a gradual increase in the amount of H2O2after hypoxia and reoxygenation. In heart, muscle and liver, the H2O2level dropped after 24 h of reoxygena-tion....

Báo cáo khoa học: Cdc37 maintains cellular viability in Schizosaccharomyces pombe independently of interactions with heat-shock protein 90 doc

... thepostulated heat-shock protein (Hsp) 90-binding and homodimerizationdomains, can also sustain cellular viability, indicating that Cdc37 dimeriza-tion and interactions with the cochaperone Hsp90 may ... overnight in MM containing adenine and uracil. The attenuance at 600 nm was adjusted to 0.5 and serial dilutions were spotted onto MM + adenine +uracil plates with and without 5¢ ﬂuoro-2¢-deoxyuridine(5FOA). ... discovered that expression ofthe N-terminal domain alone can sustain cellular via-bility. These truncated proteins do not contain the pos-tulated Hsp90-binding domain, suggesting that bindingof...

Báo cáo khoa học: The ﬁrst cytochrome P450 in ferns Evidence for its involvement in phytoecdysteroid biosynthesis in Polypodium vulgare doc

... Educacio´nyCiencia (Spain) projects AGL2001-2285 and AGL2004-05252 is acknowledged. DC thanks Generalitatde Catalunya for a predoctoral fellowship. The authorsalso thank G. Fabrias for critically reading ... ratio was analysed after 24 husing HPLC. (C) Untreated calli. The biotransformation ratio wasnormalized to untreated calli, assigned a relative activity of 1. A, aminoglutethimide; M, miconazole; ... calli. This dose wascompared with several plant P450 inhibitors on thesame reaction calli. Control calli, and P450 inhibitor-treated calli, were treated with E and after 24 h thetransformation...

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identiﬁcation of a novel subtype of thyrotropin-releasing hormone receptor ppt

... A5 1 (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); thirdset, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATGCAG-3¢)/TRHR-9 ... ampliﬁed as described above usingpartially overlapping cDNA fragments and the pair ofprimers TRHR1-2 sense (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense ... xTRHRs in the brain, liver, testis, urinary bladder, stomach, ventral and dorsal skin, lung, heart and intestine were also examined.No signal was obtained by Northern blotting, probablybecause...

Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx

... Schematic drawings of the stomach (A) , small (B) and large(C) intestinal walls. The ﬁgure shows the localization of Adh1,Adh3, Adh4 and Aldh1 mRNA expression in the rat (R) and mouse(M) gastrointestinal ... with a role in a defense system, protecting against alcohols, aldehydes and formalde-hydes as well as being involved in retinoid metabolism.AbbreviationsADH, alcohol dehydrogenase; ALDH, aldehyde ... nervoussystem in PD and found that both Meissner’s and Auerbach’s plexuses were affected already in early sta-ges of disease and terminal axons of postganglionic and preganglionic neurons contained a- synuclein-posi-tive...

Báo cáo khoa học: Stage-speciﬁc expression of Caenorhabditis elegans ribonuclease H1 enzymes with different substrate speciﬁcities and bivalent cation requirements ppt

... 10111213141516 A 5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'Ce-RNH1α, Ce-RNH1βCe-RNH 1A Ec-RNHIPf-RNHIICB3'5'Ce-RNH1α ... obtained in at least two inde-pendent experiments for each gene.rnh-1.0αrnh-1.0βαβ A UGAAAAUUUAGGAGUCAAACGUUGUUUUAGAUUCAAGAAAαβBFig. 3. Alternative splicing of rnh-1. 0a and rnh-1.0b. (A) Schematicpresentation ... were analyzed by SDS ⁄ PAGE on a 10–20% gradi-ent gel and stained with Quick-CBB (Wako, Osaka,Japan). In vitro assay for RNase H activityRNase H activity was assayed by analyzing the stability...

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... thesame as in abrin and ricin A- chains. This suggests thatthe catalytic reaction is exactly the same. The sugarbinding pulchellin B-chains are 264 (P I and P II) or263 (P III and P IV) amino acids ... galactose and galactose-containing structures, can agglutinatehuman and rabbit erythrocytes, and kills mice and themicrocrustacean Artemia salina at very low concentra-tions [10]. Similar to the ... described above.Hemagglutination and hemagglutination-inhibition assaysHemagglutination assays were carried out using normalhuman (A +,B+ and O+), horse and rabbit erythrocytes in P. V. Castilho...

Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt

... onComputational Linguistics (COLING’10), Beijing,China.Alexandru Ceaus¸u, John Tinsley, Jian Zhang, and Andy Way. 2011. Experiments on domain adap-tation for patent machine translation in the ... Uefﬁng, Gholamreza Haffari, and AnoopSarkar. 2007. Transductive learning for statisticalmachine translation. In Proceedings of the 45th An-nual Meeting of the Association of ComputationalLinguistics ... error rate training for patent translation.3 Extraction of a parallel patent corpusfrom comparable dataOur work on patent translation is based on theMAREC3patent data corpus. MAREC con-tains...

Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc

... deletions in cag-negative strains, rearrangements include an inversionof cagQ, a duplication of cagA and cagB associated with cagA degeneration, and a more complex rearrangement comprising all cag ... from Ameri-can Indians have a duplication of cagA (in a nonfunctional form) and cagB inserted into the inter-genic locus between cagP and cagQ [14] (Fig. 1B).Additionally, these islands have an ... [22,33]. Interestingly, the interactionbetween CagT and CagX was lost in a cagM mutant,indicating that it is either an indirect interaction viaCagM, or that only a ternary complex comprising allthree...

Báo cáo khoa học: "Methods and Practical Issues in Evaluating Alignment Techniques" doc

... of the alignment level. Assuming the alignment A = {al, a2 , , am} and the reference Ar = {arl, at2, , am}, with ai = (asi, ati) and arj = (arsj,artj), we can derive the following sentence-to-sentence ... to align, since it contains 94% of 1-1 align- ments, reflecting a translation strategy based on speed and absolute fidelity. In addition, this corpus contains a large amount of data that remains ... Identifying and Translating Techni- cal Terminology. In Proceedings of ANLP-94, Stuttgart, Germany. • F. D~bili, E. Sammouda, and A. Zribi. 1994. De l'appariement des roots ~ la comparaison...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM