Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

... basic peroxidase gene from Catharanthus roseus Santosh Kumar, Ajaswrata Dutta, Alok K. Sinha and Jayanti Sen National Centre for Plant Genome Research, JNU Campus, Aruna Asaf Ali Marg, New Delhi, India Catharanthus ... database, i.e. Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar. thaliana (ATP...
Ngày tải lên : 23/03/2014, 09:21
  • 14
  • 347
  • 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... GAGGCTAGATACTGCTCGATGT IL-10 forward3 TGATGATTTGGAACCATTATTGAA IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT b-Actin forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 TTGCTGATCCACATCTGCTG T7- forward TAATACGACTCACTATAGGG SP6-reverse ... Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. Ram Savan 1 , Daisuke Igawa 2 and Masahiro Sak...
Ngày tải lên : 20/02/2014, 02:21
  • 8
  • 584
  • 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢.ThethirdPCRwas carried ... proliferation assay We next analyzed the ability of recombinant SSA to stimulate human T-cells. All SSA preparations yielded Fig. 1. SDS/PAGE and immunoblot...
Ngày tải lên : 07/03/2014, 16:20
  • 9
  • 485
  • 0
Báo cáo khoa học: Identification and localization of glycine in the inner core lipopolysaccharide of Neisseria meningitidis ppt

Báo cáo khoa học: Identification and localization of glycine in the inner core lipopolysaccharide of Neisseria meningitidis ppt

... data, the majority of structural analyses on meningococcal core oligosaccharides had been per- formed following O-deacylation and/ or dephosphorylation. Naturally, base-labile residues that may ... Identification and localization of glycine in the inner core lipopolysaccharide of Neisseria meningitidis Andrew D. Cox, Jianjun Li and James C. Richards Institute for Biological Scienc...
Ngày tải lên : 23/03/2014, 21:21
  • 7
  • 449
  • 1
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... compo- nents of each reaction mixture, after their chromatographic separation and purification, were submitted to 1 HNMR (nuclear magnetic resonance) and FABMS (fast atom bombardment mass spectrum) analyses ... The concentration of both the assayed compound and its respective transformation product was determined by comparison of peak data with those obtained from authentic stand...
Ngày tải lên : 08/03/2014, 08:20
  • 10
  • 624
  • 0
Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

... Dickinson and Co.) was used to acquire and analyze data. A minimum of at least 10 000 cells was analyzed. Computation of specific constitutive activity (SCA) and relative SCA (RSCA) Given that the transfection ... 5-isothiocyanate and PI. Fluorescence emission of fluorescin 5-isothiocyanate and PI from single cells were separated and measured using the standard optics of...
Ngày tải lên : 08/03/2014, 08:20
  • 9
  • 499
  • 0
Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

... The activity in the standard assay and EPR spectra of the spin-labeled WT AP were measured after incubation in urea. The scaled mobility factor (M s ) was calculated from the central linewidth of ... reduce catalytic activity of a cold- adapted alkaline phosphatase. Biochim Biophys Acta 1774, 679–687. 32 Janeway CML, Xu X, Murphy JE, Chaidaroglou A & Kantrowitz ER (1993) Mag...
Ngày tải lên : 16/03/2014, 01:20
  • 11
  • 280
  • 0
Báo cáo khoa học: Analyzing the catalytic role of Asp97 in the methionine aminopeptidase from Escherichia coli potx

Báo cáo khoa học: Analyzing the catalytic role of Asp97 in the methionine aminopeptidase from Escherichia coli potx

... 2008) doi:10.1111/j.1742-4658.2008.06749.x An active site aspartate residue, Asp97, in the methionine aminopeptidase (MetAPs) from Escherichia coli (EcMetAP-I) was mutated to alanine, glu- tamate, and asparagine. Asp97 is the lone carboxylate ... heat of dilution, via an iterative process using the origin software package. This software pack- age uses a nonlinear least-square algorith...
Ngày tải lên : 30/03/2014, 02:20
  • 12
  • 330
  • 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... kinetic parameters K m , V max and k cat were determined for the purified AATB3. Values for K m and V max for both amino donors (l-aspartate and l-glutamate) and ac- ceptors (a- ketoglutarate and oxaloacetate) ... mML-aspartate was used as amino donor for a- ketoglutarate, and 30 m ML-gluta- mate was used as amino donor for oxaloacetate. The activity of a- ketoglutarate was adj...
Ngày tải lên : 14/03/2014, 23:20
  • 13
  • 490
  • 0
Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

... purification The gene for Xeg74 was cloned into pET26b using the T. fusca Cel 6A signal sequence (MRMSPRPLRALL GAAAAALVSAAALAFPSQAA) in place of its native signal sequence. Cel 6A, Cel6Acd, and Cel4 8A have ... by Chirco & Brown [19] and Jung et al. [12]. Glucose and xylose oligomer standards were obtained from Seikagaku America or Sigma. Preparation of GBG, GBX and tomat...
Ngày tải lên : 23/03/2014, 21:20
  • 9
  • 453
  • 0

Xem thêm