Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

... 1279 Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus Klaas E. A. Max 1 , ... Dostal L, Feske A, Max KEA, Welfle H, Balbach J & Heinemann U (2004) Single- stranded DNA bound to bacterial cold- shock pro...

Ngày tải lên: 23/03/2014, 09:21

... final sample) was used in the self-cleavage assay. (B) The calculated fraction of total DNA fragment with bound protein as dependent on the total protein added is shown for the gels in (A) . Both the ... f 0 b À K nsp K sp f b 1 À f b DNA nsp  total DNA sp  total ð1Þ where [DNA sp ] total is the molar concentration of specific sequence fragment and [DNA nsp ] tot...

Ngày tải lên: 22/03/2014, 16:20

... (E31 isoform), a variant of the protein (variant 2) with a change from E to Y at amino acid residue 31 (Fig. 1), and a mutant form of the variant (P79S). Copper was found to bind to stefin B at pH ... presence of Cu 2+ (Fig. 5E) may, similarly to P79S (Fig. 4B), arise from enhanced protein aggrega- tion rather than a conformational change. To assess prote...

Ngày tải lên: 19/02/2014, 06:20

... the appearance of a terminator was found after the stop codon of cel48C, acting as a signal structure for protein synthesis termination. The protein deduced from cel48C contained 1091 amino acids ... expres- sion and purification. The encoded enzyme, a cellulase of 1091 amino acids with a deduced molecular mass of 118 kDa and a pI of 4.85, displayed a mult...

Ngày tải lên: 08/03/2014, 02:21

... candidate). The character- istic that Common Topic relations share is that they require the identification of parallel entities (i.e., the al and bi) and relations (P0 and Px) as arguments to ... constituent in the syntax. To summarize this section, we have characterized the forms being addressed according to two features, a sum- mary of which appears in Table...

Ngày tải lên: 08/03/2014, 07:20

... independently. The tables indicate the amounts of the various cDNAs transfected into cells for each condition and apply to the data shown both above and below the table. Values represent the mean ± SD of ... format from the amino terminus to the carboxyl terminus, with repeats of the ectodomain shown as rectangles. The shaded rectangles indicate repeats 3 and 9...

Ngày tải lên: 18/02/2014, 08:20

... elucidate the potentially cooper- ative nature of the metal -binding reaction within each of the domains. Thus, the goal is to elucidate the meta- llation mechanisms of the individual domains, in the hope, ... the model of a noncooper- ative metallation mechanism. Although a distinction between partially metallated intermediates and the fully metallated holo...

Ngày tải lên: 19/02/2014, 00:20

... duplex experiments. The following primers 5¢-GTCTGGCGGAA AACCTCAGTGTGACGC-3¢ and 5¢-GACACCAGACCA ACTGGTAATGGTAGCGACCG-3¢ were used for the amplification of the 3¢ end of the b-gal gene. The presence of similar amounts ... except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGAT CCTAGCA GAAGC-3¢ were used for the PCR a...

Ngày tải lên: 19/02/2014, 18:20

... MRTFs and SRF activity. Taken together, the small GTPase acts downstream of STARS, and it seems possible that ABLIM integrates signals from the small GTPases, Rac and RhoA (via STARS) toward the actin ... Shijiazhuang, China 2 Laboratory of Clinical Investigation, National Institute on Aging, National Institutes of Health, Baltimore, MD, USA Actin is a major component of...

Ngày tải lên: 07/03/2014, 01:20

... release and caspase activation. The Bcl-2 family includes antiapoptotic members such as Bcl-2 and Bcl-XL, and proapoptotic members such as Bax, Bak, and Bim. Bax and Bak are potent regulators of cytochrome ... the release of cytochrome c and the activation of caspase-9 and caspase-3 in SH-SY5Y cells by western blot analysis. Because activation of caspase-9 and caspase-3 is requi...

Ngày tải lên: 16/03/2014, 01:20