Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... FEBS Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate Judit Marokha ´ zi 1 , ... the protease as well as its natural substrate( s) and inhibi- tor(s)]. Several potential natural substrates have been found for ZapA of P. mira...
Ngày tải lên: 23/03/2014, 09:20
... Chandrasekaran A, Srinivasan A, Raman R, Viswana- than K, Raguram S, Tumpey TM, Sasisekharan V & Sasisekharan R (2008) Glycan topology determines human adaptation of avian H5N1 virus hemagglutinin. Nat ... hemagglutinin. Nat Biotechnol 26, 107–113. 10 Srinivasan A, Viswanathan K, Raman R, Chandraseka- ran A, Raguram S, Tumpey TM, Sasisekharan V & Sasisekharan R (2008) Quantitati...
Ngày tải lên: 14/02/2014, 19:20
... and the standard proteins used for calibration were obtained from Amersham Pharmacia Biotech. CoaB assay As 4¢-phosphopantothenate is not commercially available, it was synthesized enzymatically ... 5¢-GCCAGTTTT GAATTCTGGAAAGCGC CTCG-3¢ and (reverse) 5¢-CGGGTCCA AGATCTTAA CGTCGATTTTTTTC-3¢ as primers (introduced EcoRI and BglII sites are underlined) and the purified chromo- somal DNA...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Cleavage of nonphenolic b-1 diarylpropane lignin model dimers by manganese peroxidase from Phanerochaete chrysosporium Evidence for a hydrogen abstraction mechanism docx
... extracted and prepared for analysis as described above. Chromatography and mass spectrometry GC-MS was performed at 70 eV on a Finnigan 4500 mass spectrometer using a Galaxy data system and fitted ... Kalyanaraman, B. & Kirk, T.K. (1985) Mechanism of oxidative C a –C b cleavage of a lignin model dimer by Phanerochaete chrysosporium ligninase. Stoichiometry and invol...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Elementary modes analysis of photosynthate metabolism in the chloroplast stroma ppt
... systematic organization and analysis of complex metabolic networks. Nature Biotechnol. 18, 326–332. 16. Fell, D .A. , Thomas, S. & Poolman, M.G. (1999) Modelling metabolic pathways and analysing ... technique of elementary modes analysis to determine pathways by which carbon that originates from CO 2 and/ or transitory starch can exit this group of reactions, and enter...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Structure ⁄function analysis of spinalin, a spine protein of Hydra nematocysts doc
... vesicles from the Golgi apparatus. During this process, the external tubule is assembled at the apical end of the capsule and in a later stage invag- inates into the capsule matrix and spines are assembled in ... absorbance to obtain the best linear fit of lnA versus r 2 (A is the absorbance and r is the distance from the rotor axis). A partial specific volume of 0.73 cm...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx
... S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular com- ponent in horseshoe crab hemocytes, is an antimicrobial protein ... Tachystatin B2 fragments Antibacterial P11 Tachystatin B1 42 Antibacterial P12 Tachystatin B2 42 Antibacterial P13 Tachystatin A 44 Antibacterial P14 Tachystatin A fragment A...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Active site mutants of Drosophila melanogaster multisubstrate deoxyribonucleoside kinase pot
... 5¢-GGTCTTCCCGCTGCC ATGGTTGCCCTCG ATGAG-3¢;forN28+I29toP28+H29,5¢-CTC ATCGAGGGC CCACATGGCAGCGGGAAGACCA CG-3¢ and 5¢-CGTGGTCTTCCCGCTGCC ATGTGG GCCCTCGATGAG-3¢; for Q81 to N81, 5¢-GGG CCATGCCCTTT AACAGTTATGTCACGCTGACC-3¢ and 5¢-GGTCAGCGTGACATAACT GTTAAAGGGCA TGGCCC-3¢; ... Active site mutants of Drosophila melanogaster multisubstrate deoxyribonucleoside kinase Nicola Solaroli 1,2 , Mia B...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Comparative structure analysis of proteinase inhibitors from the desert locust, Schistocerca gregaria pptx
... equential, and long-range (in cluding medium-range) NOE di stance restraints per residue for SGCI (A) and SGTI (B); angular order parameters [26] of / and w torsion angles of SGCI (C) and SGTI (D) and ... values are shown in Tables 3 and 4. Values for SGCI deviate from the canonical values and also from values observed for PMP-C [11]. H owever, the trace (a- carbons) of...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Modular kinetic analysis reveals differences in Cd2+ and Cu2+ ion-induced impairment of oxidative phosphorylation in liver pot
... the analysis, the system was modularized in two ways: (a) respiratory chain, phosphorylation and proton leak; and (b) coen- zyme Q reduction and oxidation, with the membrane potential (Dw) and fraction ... in the absence of active ADP phosphorylation (state 4), an increase in passive membrane permeability to cations and anions, uncoupling and swelling, and inhibition of r...
Ngày tải lên: 16/03/2014, 02:20