Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

... The cDNA was amplified from U66003 using primers U660035Eco2 (5¢-AATAGA GAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not (5¢-TCATAAGGCGGCCGCCTACATCG ATCTTAATCTGCTCAA-3¢). A fragment carrying At3g21260 ... (5¢-AGACTGCTCTAGAATG GGTTTCTAAACCAACACGT-3¢) and GLTP1PRON- BAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAA GGTGGG-3¢). A 1.3 kb fragment carrying the At1g21360 promoter was amplified using primers 2...

Ngày tải lên: 23/03/2014, 07:20

17 300 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... 3. 45 Ca overlay analysis of fusions of GST and recombinant OMM-64 variants (rOMM-64-I-V and -C), containing different domains of the protein, to determine the calcium-binding domain of the protein. ... was found to have a molecular mass of 64 kDa, and to contain two tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to tho...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... Ewing’s sarcoma (EWS) oncogene contains an N-terminal transcrip- tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation domain ... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T)...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... [14] whereas the NM115 strain was isolated from patients with meningococcal sepsis [15]. Strain 1000 was initially identified in a collection of meningococcal clinical isolates by virtue of its lack of ... (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C 14:0 fatty acid and a phosphate group. Variation in lipid A...

Ngày tải lên: 08/03/2014, 02:20

8 361 1
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... gene product, a DNA-binding protein. Proc.NatlAcad.Sci.USA78, 2043–2047. 13. Neuwald ,A. F.,Aravind,L.,Spouge,J.L.&Koonin,E.V.(1999) AAA+: a class of chaperone-like ATPases associated with the assembly, ... The standard curve was plotted with the logarithm of molecular mass against V e /V 0 of the standard protein. Peptidase and ATPase assays The peptidase activity of Bt-Lo...

Ngày tải lên: 16/03/2014, 16:20

11 505 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 A novel ... GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTGCAaCCCCAAAtCGGACAG 2b+ CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaA...

Ngày tải lên: 17/03/2014, 03:20

8 401 0
Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

... 5¢-ACTCAAATCACTAGTATTCTTCCACCA-3¢ and 5¢-CATTTGAACATAAACATGAACAAATAAGTT-3¢ and the following conditions: annealing temperature 55 °C, 25 cycles, Phusion polymerase used according to the manufacturer’s ... home-made databases that contain either a six frame-translation of C. papaya ESTs or a six-frame translation of C. papaya whole genome shotgun sequences. These databases were constru...

Ngày tải lên: 22/03/2014, 17:20

14 395 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

... N-Terminal processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa. A search in the PROSITE database of protein families and domains [12] with MCA2590 ... GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme protein identification in...

Ngày tải lên: 23/03/2014, 11:20

12 393 0
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

... for angiotensin II receptor (AT 1a) cDNA cloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ (forward); 5¢-CCCTTTGGAAACTGGACAGA-3¢ (reverse). Primers used for cannabinoid receptor-1 (CB-1) cDNA cloning: 5¢-GAGGACCAGGGGATGCGAAGG-3¢;5¢-TG CCCCCTGTGGGTCACTTTCT-3¢. Plasmids ... expression pattern, cellular localization and functions of RGS5s suggest that RGS5s may play a critical role in the regulation of...

Ngày tải lên: 23/03/2014, 13:20

9 312 0
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

... 4, bovine liver ferritin; lanes 2 and 5, bovine adrenal gland ferritin; and lanes 3 and 6, the 250 kDa protein. Identification of a putative MAP as ferritin M. R. Hasan et al. 824 FEBS Journal 272 ... electrophoretic mobility of bovine liver ferritin, bovine adrenal cortex Fig. 1. Amino acid sequence analysis of the 250 kDa protein. A cyanogen bromide digest of the 250 kDa pro...

Ngày tải lên: 23/03/2014, 13:20

10 232 0
w