Báo cáo khoa học: Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold potx
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt
... reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ ... Remarks 15¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx
... Haruki*, Kazufumi Takano, Masaaki Morikawa and Shigenori Kanaya Department of Material and Life Science, Graduate School of Engineering, Osaka University, Japan A psychrotrophic bacterium Shewanella ... the NdeI–BamHI sites of pET-2 8a. This DNA fragment was amplified by PCR. The sequences of the PCR primers were 5¢-AGAGAGAATT CATATGTCAGATTTGTTCAG-3¢ for the 5¢-primer and 5¢-GGCCACT GGATCCAA...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold potx
... MINIREVIEW Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold Per -A ˚ ke Nygren Department of Molecular Biotechnology, School ... be advantageous for the site-specific introduction of various labels and radionuclide chelators. Abbreviations ABD, albumin -binding domain; Ad5, adenovirus type 5; Ab, amyloid-beta...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Alternative binding proteins: Anticalins – harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities pdf
... T-cell proliferation was stimulated in a manner comparable to that of commercially available antibodies directed against the same target. Thus, the CTLA-4-specific anticalin is a promising drug candidate ... anticalin, can be readily achieved. Thus, antica- lins offer many applications, not only as reagents for biochemical research but also as a new class of potential drugs for medical t...
Ngày tải lên: 23/03/2014, 07:20
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc
... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 (1) Protein containing DNAJ domain; unknown function cuacgucggacggaacugggaaaccgaucaguguugguagugaguuaa cucggugaccgaguuaguagaacgaguuaauuag UGUAAAUAcgaagcca At4g39090 ... PHD domain; unknown function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins ppt
... measured at 298 K. Upper panel: T91C L-BABP ⁄ GCDA at a molar ratio of 1 : 3. Middle panel: T91C L-BABP ⁄ GCA at a molar ratio of 1 : 3. Lower panel: T91C L-BABP ⁄ GCDA ⁄ GCA at a molar ratio of 1 ... human ileal BABP, substantiating the proposal that BABPs have parallel functions in hepato- cytes and enterocytes. Abbreviations BA, bile acid; BABP, bile acid -binding protein; CA, chola...
Ngày tải lên: 18/02/2014, 06:20
Báo cáo khoa học: Aegyptin displays high-affinity for the von Willebrand factor binding site (RGQOGVMGF) in collagen and inhibits carotid thrombus formation in vivo ppt
... TGACGTCCTTTGGATGAAAC-3¢ (reverse); C-terminus 2, 5¢-GGAGGTGACGAAGGAGAAGATAACGC-3¢ (for- ward), 5¢-TTAATCGGCCGGATCGTTCTTTTCACTACC TTTACTGTCTTC-3¢ (reverse); mid-domain, 5¢-GGACAT GACGATGCTGGTGAGG-3¢ ... of Malaria and Vector Research, National Institute of Allergy and Infectious Diseases (NIAID) ⁄ NIH, Bethesda, MD, USA 2 Malaria Genetics Section, Laboratory of Malaria and Vector Research, Nat...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: Alternative binding modes of an inhibitor to two different kinases doc
... tetrabromobenzotriazole. Protein kinases catalyze critical post-translational phos- phorylations of proteins in almost all intracellular signaling pathways. Protein kinases have become popular targets for inhibitors and there ... indicate that similar binding modes of an inhibitor to different kinases cannot be assumed. Materials and methods Crystal preparation and data collection Human p...
Ngày tải lên: 23/03/2014, 21:20
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... 5¢-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCR product was purified, treated with T4 exonuclease to create vector-compatible ... Multiple attach hypothesis of alpha-amylase action: action of porcine pancreatic, human salivary, and Aspergillus oryzae alpha-amylases. Arch Biochem Biophys 122, 8–16. 12 Teeri TT (1997) Crystallin...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx
... B, Schatz G & Azem A (1999) Domain structure and lipid interaction of recombinant yeast Tim44. Proc Natl Acad Sci USA 96, 8890–8894. 27 Kashiwayama Y, Morita M, Kamijo K & Imanaka T (2002) ... membrane proteins by the m-AAA (i.e. matrix- oriented ATPase associated with a variety of cellular activities) protease [4]. It has been further reported that MDL1 mediates resistance agai...
Ngày tải lên: 18/02/2014, 16:20