Báo cáo khoa học: Effect of magnesium ions on the activity of the cytosolic NADH/cytochrome c electron transport system pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... skeletal muscle. Table 1 shows the effect of temperature on activation coefficient (K a ) values for allosteric activators and the values of concentration of the inhibitor that reduces control activity ... elicit an activation of PFK activity at 5 C; in fact, the addition of inorganic phos- phate resulted in an inhibition of PFK activity. Fur- ther analysis of ph...

Ngày tải lên: 19/02/2014, 16:20

9 579 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

... GTTGAGATCTGTTGTTTACTTCTTC 423 MIH-LF GAGTTATCAACGACGAGTGTCC MIH-LR GAGACGACAAGGCTCAGTCC 249 AK-LF AAAGGTTTCCTCCACCCTGT AK-LR ACTTCCTCGAGCTTGTCACG 450 CHH-SF GACTTGGAGCACGTGTGT CHH-SR TATTGGTCAAACTCGTCCAT ... if the actions of the CHH neuropeptides on repression of ecdysteroid synthesis by the Y-organ (YO) are considered. The most widely accepted paradigm of moult control in cr...

Ngày tải lên: 21/02/2014, 00:20

9 588 0
Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx

... Detection accuracies of cascading components for the lexical score. value of λ L 0.5 0.6 0.7 0.8 Accuracy (%) 84.3 84.6 85.1 84.9 Table 4: Evaluation on different weighted product fusion the ... connection in Figure 2). 4 The Lexical Score Function The main challenge of this system is the computa- tion of the lexical score g(A, W). In this paper, we propose a novel dat...

Ngày tải lên: 20/02/2014, 05:20

6 556 0
Báo cáo khoa học: Effect of magnesium ions on the activity of the cytosolic NADH/cytochrome c electron transport system pptx

Báo cáo khoa học: Effect of magnesium ions on the activity of the cytosolic NADH/cytochrome c electron transport system pptx

... the correct execu- tion of the apoptotic programme and/or the activation of the NADH/ cyto -c electron transport pathway. Abbreviations cyto-b 5 , cytochrome b 5 ; cyto -c, cytochrome c; FCCP, carbonyl ... the oxidation rate of exogenous ferrocyto -c are correlated with the frequency of speci c contact sites. With regard to the effect of magnesium on the...

Ngày tải lên: 23/03/2014, 06:20

12 441 0
Báo cáo khoa học: " Effect of the medical emergency team on long-term mortality following major surgery"

Báo cáo khoa học: " Effect of the medical emergency team on long-term mortality following major surgery"

... to the nearest level 1 trauma center of the region, the Cologne- Merheim Medical Center (CMMC). Rapid communication on different aspects associated with the long-distance air trans- fer, characteristic ... tertiary medical care provided to this unique cohort of patients, in particular with respect to complex wound management, infection and psychoemotional control. Accord- ing to...

Ngày tải lên: 25/10/2012, 10:41

9 762 0
 Báo cáo khoa học: "Effect of intern’s consecutive work hours on safety, medical education and professionalism"

Báo cáo khoa học: "Effect of intern’s consecutive work hours on safety, medical education and professionalism"

... http://ccforum.com/content/9/2/E3 529 Available online http://ccforum.com/content/9/5/528 We agree with the recommendation that further research should study the effects of sleep deprivation and work schedule ... failures after they had been working for more than 16 hours on the traditional schedule [2]. Letter Effect of intern’s consecutive work hours on safety, medical educa...

Ngày tải lên: 25/10/2012, 10:45

3 514 0
Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf

Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf

... silenc- ing capacity as in the presence of TRBP, actually becoming the most active of all the siRNAs under these conditions (Fig. 2A). In contrast, after knockdown of Dicer, only the silencing ... function of TRBP in RNAi. Here, we have characterized the interactions of siRNAs that contain terminal mismatches with TRBP and Dicer, and determined the impact of these inte...

Ngày tải lên: 18/02/2014, 06:20

10 701 0
Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx

Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx

... structural consequences of the P-loop transition that occurs upon oxidation, the program contact [17] was used to compare all the contacts made with the catalytic cysteine or cysteine sulfonic acid ... six contacts that are made directly with the cysteine S c in the unoxidized conformation. Oxidation of the catalytic cysteine decreased the contacts made to the cysteine...

Ngày tải lên: 18/02/2014, 18:20

10 597 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx

Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx

... member of the OCT family transcription factors appeared to be involved in the transactivation of the region which had the highest enhancing activity of the three DHSs. The state of acetylation in ... DHSs on the transcription of Ig-b gene and on the mainten- ance of the active chromatin state. Results Generation of DT40/Cre cells with a long deletion in o...

Ngày tải lên: 19/02/2014, 16:20

11 639 0
Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx

Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx

... side of the channel and does not penetrate to the cis side. The effect of changing cis calcium con- centration on the inhibitory effect of cis gadolinium was also investigated. When calcium concentration ... activation of the channel at 100–250 lm and inactivation at higher luminal calcium concentrations [15,16]. As the effect of the luminal cal- cium concentra...

Ngày tải lên: 19/02/2014, 16:20

8 588 1
Từ khóa:
w