Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
... organisms are capable of metabolizing methylglyoxal, via a methylglyoxal reductase-dependent pathway, to l-lactate; however, itremains to be seen whether this is the predominantpathway for methylglyoxal ... centrifugationFig. 5. Metabolism of methylglyoxal. In T. cruzi and L. major, the principal end-prod-uct of methylglyoxal metabolism isD-lactate. In the absence of GLO1, T. brucei does notmaintain ... FairlambAH (2008) Chemical and genetic validation of dihydrofolate reductase-thymidylate synthase as a drugtarget in African trypanosomes. Mol Microbiol 69,520–533. Methylglyoxal metabolism in...
- 11
- 639
- 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan-guage model adaptation are both examples of re-ranking. In these tasks, we assume that we have been ... Newspaper). But in the linear model their feature weights were trained discriminatively on an adaptation domain corpus (Encarta Encyclopedia). Thus, this forms a cross domain adaptation paradigm. ... version of Boosting with Lasso (L1) regularization. We first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model adaptation task. Then we apply...
- 8
- 504
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 941–948,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP A Comparative Study of Hypothesis Alignment ... from Machine Translation Systems. In Proceeding of EMNLP. Hawaii, US, Oct. F. Huang and K. Papinent. 2007. Hierarchical System Combination for Machine Translation. In Proceed-ings of the ... Hypotheses for Statistical Machine Transla-tion. In: Proceeding of COLING 2008. pp105-112. Manchester, UK. Aug. D. Chiang. 2007. Hierarchical phrase-based transla-tion. Computational Linguistics,...
- 8
- 546
- 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf
... ”Demokritos”,Institute of Informatics& TelecommunicationsandUniv. of Texas at Arlington,Comp. Science and Engineeringalexandros.papangelis@mavs.uta.eduAbstractAdaptive Dialogue Systems are rapidly ... withPt(dj|di, a m) ∈ [1 − , 1], with varying andavailable action density values. At each run, eachalgorithm was evaluated using the same transitionprobabilities and available actions. To assess ... SARSA(λ) (Chen andWei, 2008) is a variation of SARSA(λ) that usesthe least squares method to find the optimal pol-icy. Incremental Actor Critic (IAC) (Bhatnagaret al., 2007) and Natural Actor...
- 10
- 498
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1...
- 16
- 483
- 0
Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt
... Comparative Study of Target Dependency Structuresfor Statistical Machine TranslationXianchao Wu∗, Katsuhito Sudoh, Kevin Duh†, Hajime Tsukada, Masaaki NagataNTT Communication Science Laboratories, ... Laboratories, NTT Corporation2-4 Hikaridai Seika-cho, Soraku-gun Kyoto 619-0237 Japanwuxianchao@gmail.com,sudoh.katsuhito@lab.ntt.co.jp,kevinduh@is.naist.jp,{tsukada.hajime,nagata.masaaki}@lab.ntt.co.jpAbstractThis ... rule extracting and target dependencylanguage model (LM) training.2.2 Dependency parsingGraph-based and transition-based are two predom-inant paradigms for data-driven dependency pars-ing. The...
- 5
- 410
- 0
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx
... Pilot Study of Opinion Summarization in ConversationsDong Wang Yang LiuThe University of Texas at Dallasdongwang,yangl@hlt.utdallas.eduAbstractThis paper presents a pilot study of opinionsummarization ... like MaximalMarginal Relevance (MMR), Latent Semantic Anal-ysis (LSA), and supervised methods that cast the ex-traction problem as a binary classification task havebeen adopted. Prior research ... somewhat support, neutral, somewhat against,strongly against. Therefore for each conversation,we have an abstractive summary, an extractive sum-mary, and an overall opinion for each speaker....
- 9
- 442
- 0
Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx
... This task contains the pro-ceedings of the Canadian parliament, which are keptby law in both French and English. About 3 millionparallel sentences of this bilingual data have beenmade available ... Canadian Hansards task the coverage increasesfrom about 87% to about 96%.We have presented a polynomial-time search al-gorithm for statistical machine translation based onthe ITG constraints ... 1997). For the baseline ITG constraints, theresulting grammar is: A → [AA] | AA | f/e | f/ | /eHere, [AA] denotes a monotone concatenation andAA denotes an inverted concatenation.Let us...
- 8
- 410
- 0
Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt
... seman-tic representations, SRL has attracted much at-tention from researchers into various NLP appli-cations including question answering (Narayananand Harabagiu, 2004; Shen and Lapata, 2007;buy.v ... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 19–27,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP A Comparative Study on Generalization of ... variety of thematicroles. Zapirain et al. (2008) evaluated PropBankARG tags and VerbNetthematic roles in a state -of- the-art SRL system, and concluded that PropBankARG tags achieved a more...
- 9
- 549
- 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf
... lymphocytes.Anthracyclines are among the most potent and clinicallyuseful drugs in cancer treatment [1]. Anthracycline anti-biotics are DNA intercalators [2,3], and the antitumoractivity of daunorubicin, a prominent ... A comparative analysis of the time-dependent antiproliferativeeffects of daunorubicin and WP631Silvia Villamarı´n1,*, Sylvia Mansilla1,*, Neus Ferrer-Miralles1, Waldemar Priebe2and ... anthracyclines and the more sequence-selectivebisanthracycline WP631. To gain further insight into thecauses of the distinct behavior of daunorubicin and WP631,we compared the intracellular accumulation...
- 7
- 581
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ