Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

... cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis Santosh Chauhan, Anil Kumar, Amit Singhal, Jaya Sivaswami ... GCTGTTATACCAGTATATGG EMSA, oligonucleotides for site 3 P3R CCATAT ACTGGTATAACAGC P4F TGGTGTACTAATTTGATCTATG EMSA, oligonucleotides for site 4 P4R CA...
Ngày tải lên : 23/03/2014, 04:21
  • 12
  • 462
  • 0
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot

Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot

... GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC 1676S: GATCGCTAGCGTGTGATGAAGGCGGAAGATGTAAAAGGTG CHD3 inserts in pCMV-Tag2 1676ST: GATCGAATTCTGGAAGATGTAAAAGGTG 2000AT: GATCGTCGACATCCAGTCAGTCGTCTATAC 2000AX: GATCCTCGAGATCCAGTCAGTCGTCTATAC N-terminal ... GATCGAATTCCCCCTGCAGATGCCAAAGATG 304S: GATCGAATTCGAAGTGCCTAACTGC 343S: GATCGAATTCGAGAGACTGGAAGGCAAAG 349Rb: GATCGGATCCTCATTTGCCTTCCAGTCTCTCAG ERM C...
Ngày tải lên : 30/03/2014, 09:20
  • 15
  • 323
  • 0
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

... GGAT CCATGGTCATGGAAACATATCCATA AATCGG and CCAT CCATGGTCAGTTGATAGGAGC TGTGAAGAAAAC, respectively (all incorporating NcoI site, underlined). The resulting fragments were cloned into pEG202 using EcoRI and NcoI. The ... leads to premature aging disorder Werner syndrome); (b) the RFC4 pro- tein, a DNA binding ATPase that acts as a processivity factor for DNA polymerase delta and epsilon and...
Ngày tải lên : 23/03/2014, 15:21
  • 12
  • 468
  • 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth ... Technology, Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type...
Ngày tải lên : 15/02/2014, 01:20
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... C-terminal adenylation domain A 4 again is predicted to activate l-arginine, displaying 60% identity to the characterized A- domain of MycC. Interestingly, A 1 and A 4 inherit a highly identical (90%) ... mLÆmin )1 : lin- ear increase from 0% B to 50% within 20 min followed by a linear increase to 95% B in 5 min, holding B for an additional 5 min. This gradient was also u...
Ngày tải lên : 16/02/2014, 09:20
  • 14
  • 614
  • 0
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

... recombinant chicken RPE65 to apparent homogeneity and demonstrated its isomerohydrolase activity, exploiting a novel enzymatic assay system that utilizes all-trans-retinyl palmitate incorporated into ... higher than its calculated value (60 944 Da) based on the derived amino acid sequence [11], indicating post-translational modifications [12]. Hydropathy anal- ysis of the RPE65 amino a...
Ngày tải lên : 18/02/2014, 08:20
  • 11
  • 587
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... reactions are pipetted into a 384-well plate, and acceptor beads containing antibody against HSF1 are added to the wells. After incubation, streptavidin-coated donor beads are added, and plates are ... domain. Stable binding requires simultaneous binding of all DNA-binding domains in a trimer to three adjacent nGAAn repeats. Therefore, a functional HSE contains at least three nGAA...
Ngày tải lên : 18/02/2014, 14:20
  • 9
  • 457
  • 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis through DR5 ... Leaman DW, Chawla-Sarkar M, Vyas K, Reheman M, Tamai K, Toji S & Borden EC (2002) Identification of X-linked inhibitor of apoptosis-associated factor-1 as an interferon-stimulat...
Ngày tải lên : 19/02/2014, 06:20
  • 11
  • 679
  • 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... template. PDE1(Arg189–Thr620) was amplified using the primer pairs 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified ... antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating disease of domestic anim...
Ngày tải lên : 19/02/2014, 12:20
  • 11
  • 566
  • 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... chromatin incorpor- ating them. To see whether the increased transcription leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a time-dependent ... triamcinolone acetonide (TA) at a concen- tration of 10 )6 M . TSA was added, at the same time, to a pool of injected oocytes, these are referred to as late TSA (L). Tra...
Ngày tải lên : 19/02/2014, 12:20
  • 10
  • 500
  • 0