Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf
Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf
... ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding Federico Forneris, Roberto Orru, Daniele Bonivento, Laurent R. Chiarelli and Andrea MatteviDepartment ... folded and denatured state. The mainadvantage of the method is that it allows a large amount of biochemicaldata to be obtained using very small amounts of protein sample and stan-dard laboratory ... agents, high-affinity ligands, protein complex formation, and other factors that canaffect protein stability. This information is obviouslyvery valuable for any biochemical and biophysicalanalysis,...
- 8
- 464
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23...
- 9
- 444
- 0
Báo cáo khoa học: Spermosin, a trypsin-like protease from ascidian sperm cDNA cloning, protein structures and functional analysis doc
... a trypsin-like protease from ascidian spermcDNA cloning, protein structures and functional analysisEri Kodama1, Tadashi Baba2, Nobuhisa Kohno2, Sayaka Satoh2, Hideyoshi Yokosawa1 and ... more a ccessible thanthose in mammals, and large amounts of s perm and egg areobtainable from thousands of these animals which arecultivated in Onagawa Bay for human consumption.We have previously ... 896 Da. By sequencealignment, it was suggested that His178, A sp230 and Ser324make up a catalytic triad and that ascidian spermosin beclassi®ed as a novel trypsin family member. The mRNA ofpreprospermosin...
- 7
- 493
- 0
Báo cáo " Fishing ground forecast in the offshore waters of CentralVietnam (experimental results for purse-seine and drift-gillnet fisheries) " docx
... the last several decades, where much knowledge about the nature of the marine ecosystems has been accumulated and longer data time series are available Most variable environmental factors ... the Length-based Cohort Analysis (LCA) and Thompson and Bell models have been used. Analyzing data of fishery survey and observation from 2000 to 2009 and data from the General Statistics Office ... long-term forecast. The changes of oceanological factors in the forecast area such as temperature, salinity, currents, disturbance and displacement of water masses would affect immediately the...
- 7
- 409
- 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... was admitted to the ICU. Although we did not prospec-tively look for all missed prescriptions, standard care was for the pharmacist to review admissions and note discrepanciesbetween ward and ... interactions, con-traindications and side effects, these are for information only and decision support capability does not exist. Systems withAPACHE = Acute Physiology and Chronic Health Evaluation; CDSS ... ofstandardisation, full audit trail, legibility, use of approvednames, specification of key data fields such as route of admin-istration, storage and recall of records.Although the CPOE system...
- 6
- 526
- 0
Báo cáo khoa học: "What do we know about medication errors made via a CPOE system versus those made via handwritten orders"
... with dosages. Idiscuss these issues and their implications for the evaluation ofCPOE systems and of other emerging healthcare technologies.Shulman and colleagues [1] have contributed a thoughtfulstudy ... via a CPOE system versus those made via handwritten orders?Ross KoppelCenter for Clinical Epidemiology and Biostatistics, School of Medicine, and Sociology Department, University of Pennsylvania, ... complexity of medication prescribingerrorShulman and colleagues assign medication errors into a 12category schema that illuminates the many types ofmedication prescribing errors and, key here,...
- 2
- 524
- 1
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... decisionmaking in the ICU. In that study, a questionnaire was com-pleted for each radiograph, addressing the indication for theradiograph and whether it changed the patient's management.Of ... predefined major abnormalities on daily routine chest radiographs resulting in a change in management per admittance categoryAbnormality Diagnostic category (number of chest radiographs)Medical (422) ... analysis of thestudy. MS conceived and coordinated the study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and approved the final manuscript.AcknowledgementsAll...
- 7
- 722
- 0
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... file and the laboratory data. Renal function was noted for everypatient and renal failure was defined as calculated creatinineclearance less than 50 ml/minute. The parameters needed tocalculate ... creatinine clearance were always available inboth the PB-U and the C-U. In addition to the pharmacists'own professional knowledge, clinical guidelines (Up to Date®,Waltham, MA, USA) and ... prescriptions, physicians had to order a 'vancomycin loading dose' and a 'vancomycin dose accord-ing to plasma level', without having to adjust anything, whichvirtually eliminates the...
- 9
- 738
- 1
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... indicate that few veterinarians use data analysis in their daily practice and advice.High data qualityLow data qualityCOWPOPULATION(herd or national)FARMScoring + treatmentData analysisBothherd/general ... interviews[9]. 'Information redundancy' or 'data saturation' is a measure of the power and validity of the qualitative stud-ies [9]. Information redundancy or data saturation isreached ... data quality and different quantitative analysisThe epidemiological issue of variation and bias are linkedtightly with the terms accuracy and precision. Accuracy and precision of disease detection...
- 10
- 587
- 0
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
... at-risk hospital patients, reinforce theneed for adequately trained medical staff to be available 24hours per day, and provide useful information for allocation ofresources and personnel for ... approximately60,000 day and overnight admissions per year.Hospital emergency response teamsThe acute care hospital has two levels of medical emergencyresponses and teams. A traditional cardiac ... paging system, and a detailed log of all calls is maintained.Criteria for medical emergency team activationCalling criteria for our MET service are based on acutechanges in heart rate (<40...
- 4
- 541
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ