Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf
Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf
... ThermoFAD, a Thermofluor Ò -adapted flavin ad hoc detection system for protein folding and ligand binding Federico Forneris, Roberto Orru, Daniele Bonivento, Laurent R. Chiarelli and Andrea Mattevi Department ... folded and denatured state. The main advantage of the method is that it allows a large amount of biochemical data to be obtained using very small amou...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TT...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Spermosin, a trypsin-like protease from ascidian sperm cDNA cloning, protein structures and functional analysis doc
... a trypsin-like protease from ascidian sperm cDNA cloning, protein structures and functional analysis Eri Kodama 1 , Tadashi Baba 2 , Nobuhisa Kohno 2 , Sayaka Satoh 2 , Hideyoshi Yokosawa 1 and ... more a ccessible than those in mammals, and large amounts of s perm and egg are obtainable from thousands of these animals which are cultivated in Onagawa Bay for human consumption....
Ngày tải lên: 17/03/2014, 11:20
Báo cáo " Fishing ground forecast in the offshore waters of CentralVietnam (experimental results for purse-seine and drift-gillnet fisheries) " docx
... the last several decades, where much knowledge about the nature of the marine ecosystems has been accumulated and longer data time series are available Most variable environmental factors ... the Length-based Cohort Analysis (LCA) and Thompson and Bell models have been used. Analyzing data of fishery survey and observation from 2000 to 2009 and data from the General Statist...
Ngày tải lên: 22/03/2014, 12:20
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... was admitted to the ICU. Although we did not prospec- tively look for all missed prescriptions, standard care was for the pharmacist to review admissions and note discrepancies between ward and ... interactions, con- traindications and side effects, these are for information only and decision support capability does not exist. Systems with APACHE = Acute Physiology and Chronic...
Ngày tải lên: 25/10/2012, 10:39
Báo cáo khoa học: "What do we know about medication errors made via a CPOE system versus those made via handwritten orders"
... with dosages. I discuss these issues and their implications for the evaluation of CPOE systems and of other emerging healthcare technologies. Shulman and colleagues [1] have contributed a thoughtful study ... via a CPOE system versus those made via handwritten orders? Ross Koppel Center for Clinical Epidemiology and Biostatistics, School of Medicine, and Sociology Departme...
Ngày tải lên: 25/10/2012, 10:39
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... decision making in the ICU. In that study, a questionnaire was com- pleted for each radiograph, addressing the indication for the radiograph and whether it changed the patient's management. Of ... predefined major abnormalities on daily routine chest radiographs resulting in a change in management per admittance category Abnormality Diagnostic category (number of chest radiogr...
Ngày tải lên: 25/10/2012, 10:39
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... file and the laboratory data. Renal function was noted for every patient and renal failure was defined as calculated creatinine clearance less than 50 ml/minute. The parameters needed to calculate ... creatinine clearance were always available in both the PB-U and the C-U. In addition to the pharmacists' own professional knowledge, clinical guidelines (Up to Date ® , Waltham, MA,...
Ngày tải lên: 25/10/2012, 10:39
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... indicate that few veterinarians use data analysis in their daily practice and advice. High data quality Low data quality COW POPULATION (herd or national) FARM Scoring + treatment Data analysis Both herd/general ... interviews [9]. 'Information redundancy' or 'data saturation' is a measure of the power and validity of the qualitative stud- ies [9]. Information red...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
... at-risk hospital patients, reinforce the need for adequately trained medical staff to be available 24 hours per day, and provide useful information for allocation of resources and personnel for ... approximately 60,000 day and overnight admissions per year. Hospital emergency response teams The acute care hospital has two levels of medical emergency responses and teams. A trad...
Ngày tải lên: 25/10/2012, 10:45