Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

... 237 amino acids 15 amino acids ⁄ 14 amino acids 25 kDa ⁄ 4.07 PaTry2 GU338028 870 798 nucleotides 58 nucleotides AATAAA ⁄ 10 nucleotides 266 amino acids ⁄ 237 amino acids 15 amino acids ⁄ 14 amino ... nucleotides ATTAAA ⁄ 13 nucleotides 278 amino acids ⁄ 249 amino acids 15 amino acids ⁄ 14 amino acids 27 kDa ⁄ 4.6 New members of the brachyurins family in l...
Ngày tải lên : 23/03/2014, 03:20
  • 13
  • 474
  • 0
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

... monitoring the change in the concentration of p-nitroaniline. The increase in the rate of isomerization is implicit in the increased rate of p-nitro- aniline release, because catalysis of isomerization ... cellular contents of the proteins that are associated with adaptation at these conditions usually increase. More specifically, the cellular content of a p...
Ngày tải lên : 16/03/2014, 16:20
  • 10
  • 436
  • 0
Báo cáo khoa học: New application of firefly luciferase ) it can catalyze the enantioselective thioester formation of 2-arylpropanoic acid docx

Báo cáo khoa học: New application of firefly luciferase ) it can catalyze the enantioselective thioester formation of 2-arylpropanoic acid docx

... differentiate the chirality of 2-phenylbutanoic acid and the ee value of unreacted acid was almost the same as the case of 2-phenylpropanoic acid. In the case of 2-hydroxymethylpropanoic acid (tropic acid) , which ... ketoprofenyl- CoA catalyzed by LUC-H was examined to obtain the detailed reaction information. The efficiency of thioest- er formation was calcu...
Ngày tải lên : 07/03/2014, 10:20
  • 9
  • 477
  • 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... change of the Fe(II) spin state and no replacement of any of the two axial ligands of the iron, His18 or RNO, by an amino acid side-chain of the antibody protein. Binding site topology of antibody ... the binding of a ligand, such as nitrosoalcane, to the iron of MP8, it brings a partial steric hindrance on the distal face of MP8 and thus controls acces...
Ngày tải lên : 19/02/2014, 12:20
  • 7
  • 447
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

... indolepyruvate decarboxylase from Enterobacter cloacae , an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid Anja Schu¨tz 1 , Tatyana Sandalova 2 , Stefano Ricagno 2 , Gerhard ... decarboxylase, suggesting that the interactions with the cofactor thiamin diphosphate and the catalytic mechanisms are very similar. The substrate binding site in...
Ngày tải lên : 20/02/2014, 11:20
  • 10
  • 557
  • 0
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx

Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx

... yields information on the chemical nature of the individual radicals of the radi- cal pair state, and their interaction with each other and with their immediate surroundings. EPR ⁄ ENDOR investigations ... spectrum of the flavin radical of a protein-bound FMN radical of the LOV1 domain (C57M mutant) of Chlamydomonas reinhardtii phototropin [34]. Experimental and cal...
Ngày tải lên : 16/03/2014, 02:20
  • 14
  • 379
  • 0
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Histone demethylase LSD1 and chromatin pot

Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Histone demethylase LSD1 and chromatin pot

... (peroxisome) LAAO (snake) 19 4.0 L -amino acids amino acids metabolism (venom toxin?) GOX (bacterial) 14 4.0 glycine, sarcosine amino acids metabolism MSOX (bacterial) 10 4.3 sarcosine amino acids metabolism Flavin-dependent ... with other flavin amine oxidases, including the overall fold of the amine oxidase domain region and details in the active site that are relevant for...
Ngày tải lên : 16/03/2014, 02:20
  • 9
  • 307
  • 0
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: An unexpected role for quinone reductases as regulators of proteasomal degradation pptx

Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: An unexpected role for quinone reductases as regulators of proteasomal degradation pptx

... state governs the association of Yap4p and Lot6p. Although it appears likely that the redox state of the FAD cofactor of NQO1 and NQO2 plays a similar role in the mammalian system, unequivocal ... acid side chains (Fig. 2) [68]. As mentioned in the introduc- tion, QRs also adopt a flavodoxin-fold and the isoal- loxazine ring engages in a similar interaction wit...
Ngày tải lên : 16/03/2014, 02:20
  • 12
  • 424
  • 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 9903 10318 415 C. Gijavanekar et al. PCR detection...
Ngày tải lên : 14/02/2014, 19:20
  • 12
  • 795
  • 0
Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

... (Osaka, Japan). BM CGTase was obtained from Amano Enzyme Inc. (Aichi, Japan) and had a specific activity of 1003 UÆmg )1 of dextrinizing activity [13]. A1 1 CGTase was purified using starch adsorption ... resulting from an increase in the turnover rate (k cat ) and the binding affinity (K m ) (Table 3). The K m values of the CLIP CGTases in the coupling reaction indicate...
Ngày tải lên : 07/03/2014, 10:20
  • 10
  • 562
  • 0