Báo cáo khoa học: Hydrogen peroxide efflux from muscle mitochondria underestimates matrix superoxide production – a correction using glutathione depletion pptx
... space Fum NAD + OAA αKG NAD + Matrix OAA ASP Complex number I II III O 2 – . AA e – Q QH 2 Q o AA Stig Rot Succinate αKGDH O 2 – . . O 2 – . O 2 – . Rot NADH Malate O 2 – MDH Glutamate . O 2 – Site ... FEBS Hydrogen peroxide efflux from muscle mitochondria underestimates matrix superoxide production – a correction using glutathione...
Ngày tải lên: 22/03/2014, 21:21
... onstruct an expression vector for Cl -idh,two oligonucleotides (sense, 5¢ -A AAAA CATATGGCAAGCA AATCGACCATCATCTACAC-3¢, and antisense, 5¢-AAA AA GGATCCCGGCTGAAAACCGGGCTGCATTA-3¢) were designed for amplification ... including aero bic bacteria [ 5], f acultative anaerobic bacteria [6], archaea [7], yeast [8], plants [9], and mammalian tissues [10] [11]. IDH in the TCA cycle catalyzes the oxida...
Ngày tải lên: 08/03/2014, 10:20
... 115.3 3–1 46.13 2.75 2.5 7–2 .95 NA NA NA NA Arachidonate 10 23.71 22.9 1–2 4.58 6.10 6.0 6–6 .15 NA NA NA NA 25 42.65 38.2 8–4 7.66 3.57 3.4 3–3 .71 NA NA NA NA 45 57.51 55.2 4–5 9.60 3.68 3.6 2–3 .73 NA NA NA NA 65 ... 5.4 3–6 .38 5.81 5.7 0–5 .93 NA NA NA NA Oleate 10 12.58 11.6 8–1 3.41 4.54 4.4 8–4 .60 NA NA NA NA 25 20.09 18.7 6–2 1.26 3.65 3.5 6–3 .73 NA NA...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Hydrogen independent expression of hupSL genes in Thiocapsa roseopersicina BBS pot
... (5¢-ACATATGAACCTGTTATGGCTC CAG-3¢)–TUVo28 (5¢-AAGCTTGTGGACCGTGCAGAC CAT-3¢) PCR fragment was cloned into the corresponding sites of pMHE6crtKm [30] resulting in pMHEUVC2. Isolation of total RNA and ... RT-PCR analysis RNA was isolated from cells using the TRI reagent (Sigma, St Louis, MO, USA), following the manufacturer’s recom- mendations. Isolated total RNA was treated with RNase-free...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: "Fast, Space-Efficient, non-Heuristic, Polynomial Kernel Computation for NLP Applications" docx
... implementation is available as the open-source splitSVM Java library. 1 Introduction Over the last decade, many natural language pro- cessing tasks are being cast as classification prob- lems. These are ... achieved by taking into account the Zipfian nature of natural language data, and structuring the compu- tation accordingly. On a sample application (replac- ing the libsvm classifier used b...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: "CD ER: Efficient MT Evaluation Using Block Movements" doc
... evaluated using different automatic evaluation measures. Pear- son’s correlation coefficient r between automatic evaluation and the sum of fluency and adequacy was calculated. As it could be arguable ... measures are used in most MT research tasks. A high correlation between these automatic evaluation measures and human evaluation is thus desirable. State-of-the-art measures such as BLEU (P...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: Hydrogen bond residue positioning in the 599–611 loop of thimet oligopeptidase is required for substrate selection pdf
... FwRepG60 3A (CTTTTGGCCA CCTCGCTGCTGGCTACGACGCTCAGTAC); RvRepG- 60 3A (GTACTGAGCGTCGTAGCCAGCAGCGAGGTG GCCAAAAG); FwRepG60 4A (GGCCACCTCGCTGGTG CCTACGACGCTCAGTAC); RvRepG60 4A (GTACTGA GCGTCGTAGGCACCAGCGAGGTGGCC); ... FwRepG- 59 9A (CAACATGCCAGCCACTTTTGCCCACCTCGCT GGTGGCTACG); RvRepG59 9A (CGTAGCCACCAGC GAGGTGGGCAAAAGTGGCTGGCATGTTG); FwRep- Y605F (CCACCTCGCTGGTGGC TTCGACGCTCAG TACTATG); R...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... epidermal keratinocytes. J Biol Chem 271, 2624 2– 26250. 20 Matsuki M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishi- ma Y, Tabata K, Yasuno H et al. (1998) Defective ... physio- logical function and physiological relevance. FEBS J 272, 61 5–6 31. 28 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: "FSA: An Efficient and Flexible C++ Toolkit for Finite State Automata Using On-Demand Computation" ppt
... Statistical Machine Translation Statistical machine translation may be viewed as a weighted language transduction problem (Vidal, 1997). Therefore it is fairly easy to build a machine translation ... the AT&T FSM Library TM through its ASCII-based input/output format. In addition, a new XML-based file format primarly designed as being human readable and a fast binary file format are...
Ngày tải lên: 23/03/2014, 19:20
Tài liệu Báo cáo khoa học: Chromatin under mechanical stress: from single 30 nm fibers to single nucleosomes pdf
... composition are also very important factors, as they can influence the octamer stability or the DNA–octamer association strength. It is also clear that the choice of DNA substrate has an impact on the ... and manipulation of viruses and bacteria. Science 235, 151 7–1 520. 2 Ashkin A, Dziedzic JM & Yamane T (1987) Optical trapping and manipulation of single cells using infrared laser b...
Ngày tải lên: 14/02/2014, 18:20