Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot

Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot

Báo cáo khoa học: Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall pot

... 2010 The Authors Journal compilation ª 2010 FEBS 172 5 Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall Marc Torrent, Marina Badia, ... lanes: cells incubated with 5 l M of RNase 3 at 0, 1, 2, 3 and 4 h. M. Torrent et al. RNase 3 and RNase 7 bactericidal activity...

Ngày tải lên: 22/03/2014, 21:20

13 465 0
Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

... consortium. A 250 B 248 B 246 B 2 47 C 245 C 232 D 260 D 32 6 B 33 6 B 33 8 B 33 9 C 34 5 C 36 0 C 36 3 D 37 4 D 4 03 NT NT NT NT NT NT NT NT NT NT NT NT NT NT NT NT B 251 B 248 B 132 B 2 47 C 252 C 245 D 260 D 31 9 B 34 4 B 35 7 B 36 7 B 37 3 C 38 5 C 39 5 D 404 D 422 NT ... Profiles of membrane fractions from CRC patients FEBS Journal 277 (2010) 30 28 30 38 ª 2...

Ngày tải lên: 16/02/2014, 15:20

11 590 0
Báo cáo khoa học: Comparison of the inward- and outward-open homology models and ligand binding of human P-glycoprotein potx

Báo cáo khoa học: Comparison of the inward- and outward-open homology models and ligand binding of human P-glycoprotein potx

... ID 3G60), 11 common residues were found for both P-gp molecules (A and B) in the unit cell; mouse Tyr3 03 (human Tyr3 07) , Leu 335 (human L 339 ) and Ser725 (human Ala729) were also involved in the ... [20, fig. 3] , mouse Ser725 (human Ala729) and Ala981 (human Ala985) for the ligand in molecule A, and Phe71 (human Phe72), Leu 971 (human Leu 975 ) and Ala981 (human...

Ngày tải lên: 29/03/2014, 22:21

11 428 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG Spcoq7-z CAGGCAAGTCTGTTTATTG Spcoq7-m CTTGGATGAGCTTTCCAC Spcoq3-w CGTATAAATTACAATACCG Spcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z ... CCCCCGGGGCCACTTTCTGGTG Spcoq7-a GTACAAGCTTGTAAATTTTCGATGG Spcoq7-b CATAGAATTCTTGGTAATC Spcoq7-c AAAGTCGACATGTTGTCACGTAGACAG Spcoq7-w CAAGCAGGTGAATTAGG...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... assays, the locations of the primers DN+ 232 and DN+254 utilized in 5¢-RACE, and the locations of the primers DN +38 5 and DN +72 1 used in 3 -RACE. Y. Kominato et al. Promoters of human deoxyribonuclease ... 0.5 luc luc luc luc luc luc luc luc luc 1 pGL3-Basic Vector −1053M − 231 M − 1 37 M 78 M −54M 33 M −28M −17M +1M luc −116M luc − 138 6M − 138 A 6 B − 139 52 − 1...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx

Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx

... regardless of whether urea or GdnHCl is used as the denaturant. The native HPI fraction decreased rapidly even at the lowest concentration of denaturant, such that  30 % of the native HPI fraction ... concentration of denaturant. Fig. 3. Unfolding of HPI in the presence of denaturant and thiol cata- lyst. Controls for the disulfide scrambling method include the...

Ngày tải lên: 19/02/2014, 12:20

11 528 0
Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc

Tài liệu Báo cáo khoa học: Comparison of the substrate specificity of two potyvirus proteases doc

... interpret the kinetic data. A comparison of the two structures and the experimental data suggested that the differences in the specificity of the two enzymes may be mainly due to the variation in their ... in the S3 pocket of the TEV prote- ase appears to be Lys220 (Fig. 4A). The OH of the P3 Tyr forms hydrogen bonds with the side chains of Asp148 and As...

Ngày tải lên: 19/02/2014, 16:20

10 524 0
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

... 5000 GST-hEAG( 674 –8 67) GST-C34 1 27 ± 15 12 83 ± 176 GST-hEAG( 674 –8 67) _F714SF 71 7S GST-C34_ FSÆFS 73 5 ± 114 > 5000 GST-hEAG(649–8 67) GST-C2B34 116 ± 44 134 3 ± 2 13 GST-hEAG(649–8 67) _F714SÆF717S GST-C2B34_FSÆFS ... 1 17 > 5000 GST-hEAG(649–8 67) _F714SÆF717SÆL 674 NÆI 678 N GST-C2B34_FSÆFSÆLNÆIN 71 4 ± 52 > 5000 GST-hEAG(649–8 67) _F714SÆF717SÆR 677 NÆR681N GST-C2B3...

Ngày tải lên: 07/03/2014, 12:20

13 500 0
Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

... at pH 7 and in the forms aggre- gated at pH 4.8 and pH 3. 3, inserted readily and to a higher final pressure. Stefin B at pH 7 and aggregates at pH 3. 3 showed slower kinetics of insertion than the aggregates ... indication about the amphipathicity of the protein. Stefin B aggregates obtained at pH 4.8 or 3. 3 insert much more readily into an air–water interf...

Ngày tải lên: 07/03/2014, 17:20

10 477 0
Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

... February 20 03, accepted 25 February 20 03) Eur. J. Biochem. 270 , 178 4– 179 0 (20 03) Ó FEBS 20 03 doi:10.1046/j.1 432 -1 033 .20 03. 035 37. x Arabinofuranosylcytocine (AraC) has a hydroxyl group in the trans ... m M Tris/HCl pH 7. 5, 5m M MgCl 2 and the substrates at 37 °C. The reaction was stopped at 2, 4 and 6 min by adding 3 lL aliquots of the reaction mixture...

Ngày tải lên: 08/03/2014, 02:20

7 384 0
w