Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ ... follows. The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCT...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo khoa học: "The Manually Annotated Sub-Corpus: A Community Resource For and By the People" potx

Báo cáo khoa học: "The Manually Annotated Sub-Corpus: A Community Resource For and By the People" potx

... Tools The ANC project provides an API for GrAF an- notations that can be used to access and manip- ulate GrAF annotations directly from Java pro- grams and render GrAF annotations in a format suitable ... USA becky@cs.columbia.edu Abstract The Manually Annotated Sub-Corpus (MASC) project provides data and annota- tions to serve as the base for a community- wide annotation effort...

Ngày tải lên: 30/03/2014, 21:20

6 374 0
Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

... molecules . 3 The language of a grammar is the set of all syntagmas generated from the start symbol , i.e., . The set of all syntagmas generated by a grammar is . Given a LWFG we call a set a sublanguage ... grammar lattice. All grammars generate , and only generates ( is a common lexicon for all the grammars) 3 A Grammar Lattice as a Search Space for Grammar Ind...

Ngày tải lên: 08/03/2014, 02:21

8 402 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... L-glutamate. The activity of L-aspartate was adjusted to 100. b 30 mML-aspartate was used as amino donor for a- ketoglutarate, and 30 m ML-gluta- mate was used as amino donor for oxaloacetate. The activity ... oxaloacetate. The aromatic amino acid aminotransferases were assayed according to Mavrides and Orr [37]. The assay was estab- lished for AAT except that aspartate was rep...

Ngày tải lên: 14/03/2014, 23:20

13 490 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... neutral and alkaline pH; PhyH-DII was less sta- ble under the same conditions (Fig. 2D). PhyH was basically stable at 35 °C, and retained 60% of the initial activ...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Báo cáo khoa học: The capsid protein of human immunodeficiency virus: intersubunit interactions during virus assembly doc

Tài liệu Báo cáo khoa học: The capsid protein of human immunodeficiency virus: intersubunit interactions during virus assembly doc

... those forming the mature capsid are different, at least in part. CA appears to have evolved an extraordinary conformational plastic- ity, which allows the creation of multiple CA–CA interfaces and ... mature capsid. Remarkably, the CA poly- peptide appears to have evolved an extraordinary con- formational plasticity, which allows the creation of diverse CA–CA interfaces and other CA–l...

Ngày tải lên: 18/02/2014, 06:20

12 577 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

... picolinic acid (PA), quinolinic acid (QA) and NAD homeostasis. Indeed, the enzyme stands at a branch point of the tryptophan to NAD pathway, and deter- mines the final fate of the amino acid, i.e. transformation ... profile and the associated variation in QA and PA levels [7], and other investigations have clearly demonstrated that changes in ACMSD activity are readily reflected by s...

Ngày tải lên: 18/02/2014, 06:20

9 796 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... of the type o f Graph 1 (these paths may contain parallel and antiparallel arrows). The sign of that element therefore depends on the both the sign and the magnitudes of these influen ce paths ... its degradation ( a js a js ) and a second influence through its autocatalytic feedback ( +a js b js ) through the same reaction, v s . The latter influences cancel each other, agai...

Ngày tải lên: 19/02/2014, 16:20

11 639 0
Tài liệu Báo cáo khoa học: The tungsten-containing formate dehydrogenase from Methylobacterium extorquens AM1: Purification and properties docx

Tài liệu Báo cáo khoa học: The tungsten-containing formate dehydrogenase from Methylobacterium extorquens AM1: Purification and properties docx

... Fdh1B (both at 58%) are translated from the chromosomes of M. capsulatus and of the unknown bacterial contaminant of L. major DNA (see above). In these two latter cases, the polypeptides also reveal the ... 1.6 m M for sodium formate and 0.07 m M for NAD + . Sodium azide is known as a transition state analogue of formate and therefore a general inhibitor of FDHs [39]. A 50%...

Ngày tải lên: 20/02/2014, 23:20

9 462 0
Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... N-terminal, regulatory and C-terminal, catalytic subdomains. The regulatory domain contains a dimerization site, an auto-inhibitory motif and several autophosphorylation sites that have an effect ... and later decreased again between 4 and 8 m urea. A clear shift in maximal emis- sion wavelength (MEW) between the native and the fully denatured state (0 and 8 m urea) was detected. In...

Ngày tải lên: 07/03/2014, 09:20

13 440 0
Từ khóa:
w