... "I saw at once," said her companion after a pause, "that you had caught a personality." " ;A personality!" Lady Henry gave an angry laugh. "That's one way of ... of marvellous youth, painter, poet, and sailor, who as a gay naval lieutenant had entertained Byron in the Ægean; whose fame as one of the raciest of naval reformers was in all the...
Ngày tải lên: 22/03/2014, 18:20
... scientific and medical research Open Access Full Text Article 6451 Iniximab therapy in pediatric Crohn’s disease: a review Kalyan Ray Parashette 1 Raghavendra Charan Makam 2 Carmen Cuffari 3 1 Department ... inhibitory agents, including adalimumab and certolizumab. Adalimumab (fully human anti-TNF) has recently received approval for the treatment of active CD. Several studies have shown...
Ngày tải lên: 22/03/2014, 10:20
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A)...
Ngày tải lên: 26/10/2012, 10:04
Tài liệu Kidney Failure - CHOOSING A TREATMENT THAT’S RIGHT FOR YOU docx
... Hemodialysis • Hemodialysis Dose and Adequacy • Peritoneal Dialysis Dose and Adequacy • Amyloidosis and Kidney Disease • Anemia in Kidney Disease and Dialysis • Renal Osteodystrophy • Financial ... proper balance of important chemi- cals such as potassium, sodium, calcium, and bicarbonate. How It Wo r k s Hemodialysis uses a special filter called a dialyzer that func- tions as an artifici...
Ngày tải lên: 24/12/2013, 16:15
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... DNA sequences flanking the Jannaschia sp. CCS1 HYD Js revealed an ORF encoding a putative allantoate amido- hydrolase, which is part of the urate catabolic pathway in many organisms [8]....
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx
... Schapira AH (2008) Mitochondria in the aetiology and pathogenesis of Parkinson’s disease. Lancet Neurol 7, 97–109. 4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai- to M, Maruyama M, Takahashi ... Jonnalagada S, Chernova T et al. (1998) The ubiquitin pathway in Parkinson’s disease. Nature 395, 451–452. 60 Yokota T, Sugawara K, Ito K, Takahashi R, Ariga H & Mizusawa H (2003) Down regu...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense). Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ (antisense). Caspase 3 activity Cells ... intensity was determined using imagemaster 2d elite software 4.01 (Amersham Bioscience, Uppsala, Sweden). Statistical analysis Data in bar graphs are expressed as the mean and standard deviation o...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... HDH, human DNA helicase; eIF-4 A, eukaryotic translation initiation factor 4A. Property PDH45 a PDH65 b PDH120 Molecular mass: SDS/PAGE 45.5 kDa 65 kDa 54 and 66 kDa Native 45.5 kDa 65 kDa 120 kDa Oligomeric ... 2A, lane 4) and ssDNA-dependent ATPase activity (data not shown) sedimented together between alcohol dehydrogenase and BSA (fraction 11) and gave a molecular mass of 120 kDa wit...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo Y học: A novel, inducible, citral lyase purified from spores of Penicillium digitatum docx
... were pooled. HA and DEAE were both operated with a Gradifac system (Pharmacia Biotech, Roosendaal, the Netherlands). Concentration and gelfiltration chromatography. After HA/DEAE active fractions were ... reaction the actions of a hydratase and an aldolase are needed. Citral lyase of P. digitatum combines hydratase and aldolase activity in a single enzyme. No other enzyme has been report...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor docx
... 1 CGACAGgtgagt)3069 bpÀcaacagGTATAT Intron 2 TTTTGTgtaaat)146 bpÀcaacagGTATAA Intron 3 AGACGGgtatga)469 bpÀtttcagGTAGTG Intron 4 TGCCAGgtatgt)119 bpÀttccagATTCCG Fig. 5. Schematic representation ... first-strand cDNA was amplified using the degenerate primers 5¢-AI (A/ C)GIATG (A/ C)GIACIGTIA CIAA(T/C)TA(T/C)TT-3¢ (I represents an inosine residue) and 5¢-CA (A/ G)CA (A/ G)TAIATIGG (A/ G)TT (A/...
Ngày tải lên: 21/02/2014, 03:20