Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf
Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf
... 5¢-ACTCAAATCACTAGTATTCTTCCACCA-3¢ and 5¢-CATTTGAACATAAACATGAACAAATAAGTT-3¢ and the following conditions: annealing temperature 55 °C, 25 cycles, Phusion polymerase used according to the manufacturer’s ... activity of the latex of Vasconcel- lea heilbornii and the identification of a putative homologous lipase from Carica papaya. Triacylglycerol lipase activity was enrich...
Ngày tải lên: 22/03/2014, 17:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... structure–function relationship analysis of Prismalin–14 from the prismatic layer of the Japanese pearl oyster, Pinctada fucata. FEBS J 274, 5158–5166. 9 Murayama E, Takagi Y, Ohira T, Davis JG, Greene MI & Nagasawa H ... M, Hasegawa K, Horita C & Akera S (1999) A new matrix protein family related to the nacreous layer formation of Pinctada fucata. FEBS Lett 462, 225–229. 5...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... 1000 (Table 1). Core oligosaccharide from the 1000 galE mutant strain was also prepared and examined by MS. A range of molecular masses was found for the core oligosaccharide consistent with a composition ... equimolar ratios. O-Deacylated LPS (LPS-OH) from all strains was prepared by hydrazinolysis, and initial analyses were carried out by negative-ion ESI-MS and CE-ESI-MS (T...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... were purchased from Sigma. DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction enzyme analysis were performed by the standard methods ... 811–819. 28. Lanzetta, P .A. , Alvarez, L.J., Reinach, P.S. & Candia, O .A. (1979) An improved assay for nanomole amounts of inorganic phos- phate. Anal. Biochem. 100, 95–97. 29....
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx
... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC 2– G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCC 1– GGGC aagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG 2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTG...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt
... (5¢-AATAGA GAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not (5¢-TCATAAGGCGGCCGCCTACATCG ATCTTAATCTGCTCAA-3¢). A fragment carrying At3g21260 cDNA was amplifed from A. thaliana RNA by RT-PCR. RNA was isolated from ... (5¢-AGACTGCTCTAGAATG GGTTTCTAAACCAACACGT-3¢) and GLTP1PRON- BAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAA GGTGGG-3¢). A 1.3 kb fragment carrying the At1g21360 promoter was ampli...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... GGCAACGAGCAAGGTCCGAAG mopE–R 2589 R AAGTCGTTGCAATCGGCGTCG sapE–F 2590 F GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme ... would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa. A search in the PROSITE database of protein families and domains [12]...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt
... for angiotensin II receptor (AT 1a) cDNA cloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ (forward); 5¢-CCCTTTGGAAACTGGACAGA-3¢ (reverse). Primers used for cannabinoid receptor-1 (CB-1) cDNA cloning: 5¢-GAGGACCAGGGGATGCGAAGG-3¢;5¢-TG CCCCCTGTGGGTCACTTTCT-3¢. Plasmids ... expression pattern, cellular localization and functions of RGS5s suggest that RGS5s may play a critical role in the regulation of...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf
... Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka, Japan 2 Department of Biological Sciences, Faculty of Science, Kanagawa University, Hiratsuka, Kanagawa, Japan Although ... purification and partial characterization of a putative microtubule-associated protein (MAP) from bovine adrenal cor- tex with an approximate molecular mass of...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... Dissociation and reassociation was analysed by SDS ⁄ PAGE. Two micrograms of pro- tein were loaded on each lane and the gel was stained with silver. M, Bio-Rad 11 broad molecular mass standard (Bio-Rad ... served as template for the amplifi- cation of the oad-1 and oad-2 genes by PCR [21]. For the expression of oadA-2 with an N- or C-terminal His tag oadA-2 was amplified from pET24-...
Ngày tải lên: 23/03/2014, 13:20