Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf
... Signal 21, 1626–1633. 84 Kurabayashi N, Hirota T, Sakai M, Sanada K & Fuk- ada Y (2010) DYRK 1A and glycogen synthase kinase 3beta, a dual-kinase mechanism directing proteasomal degradation of ... Sharma S, Nardone J, Tanasa B, Iuga A, Srikanth S, Okamura H, Bolton D, Feske S, Hogan PG et al. (2006) A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as regulat...
Ngày tải lên: 22/03/2014, 16:21
... spreading activation, the syntactic category aspect of each meaning in turn activates the category's meaning in the grammar space representation. Part of the grammatical meaning of any ... (Cf Studies of agrammatic and Broca's aphasia as described in Goodenough, Zurif, and Weintraub, 1977; Goodglass, 1976; Goodglass and Berko, 1960; Goodglass, Gleason, Bernholtz,...
Ngày tải lên: 08/03/2014, 18:20
... 20 years of research. Psy- chological Bulletin, 124:372–422. Brian Roark, Asaf Bachrach, Carlos Cardenas, and Christophe Pallier. 2009. Deriving lexical and syn- tactic expectation-based measures ... R ´ ejean Ducharme, Pascal Vincent, and Christian Jauvin. 2003. A neural probabilis- tic language model. Journal of Machine Learning Research, 3:1137–1155. Marisa Ferrara Boston, John Hale,...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: Neuropeptide S as a novel arousal promoting peptide transmitter pdf
... Functionally, central administration of NPS increases locomotor activity in both naı ¨ ve and habituated mice. It also significantly increases wakefulness and decreases paradoxical (rapid eye ... area, the principle 5 sensory nucleus and the lateral parabrachial nucleus of the brain- stem. A small number of scattered NPS-positive cells were found in other brain areas, such as amygdal...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... enzymes that lead to extracellular matrix degra- dation (matrix metalloproteases) [75–78]. In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and ... and not to an increase in its stabilization. Indeed, although HIF- 1a may be extre- mely rapidly degraded when cells are reoxygenated, its degradation after 4 min of reoxygenation was not...
Ngày tải lên: 30/03/2014, 04:20
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... to lm) and stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galactosidase A variants ... 1432–1444. 16 Ishii S, Kase R, Sakuraba H & Suzuki Y (1993) Characterization of a mutant alpha-galactosidase gene-product for the late-onset cardiac form of Fabry disease. Bioche...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... recovered differentially based on varying stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of ... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... Actions have a number of param- eters, as well as a precondition and effect, both of which are logical formulas. When a planner tries to apply an action, it will first create an action instance by ... (Fikes and Nils- son, 1971). In this paradigm, a planning state is defined as a finite set of ground atoms of predicate logic that are true in this state; all other atoms ar...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes. The rule i s constructed with training set of samples, and ... with a window of five wavenumbers, assuming that adjacent wavenumbers are highly corr elated. A population o f 3 2 solutions was built at each generation, and e valuated. Th...
Ngày tải lên: 21/02/2014, 03:20