Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc
... FEBS
Nautilin-63, a novel acidic glycoprotein from the
shell nacre of Nautilus macromphalus
Benjamin Marie
1,2
, Isabelle Zanella-Cle
´
on
3
, Marion Corneillat
4
, Michel Becchi
3
,Ge
´
rard Alcaraz
2,4
,
Laurent ... understand
the molecular mechanism that controls the formation of the shell nacreous
layer, we have investigated the biochemistry of Nauti...
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... procedure
The assay was run as a three-step assay: initial incubation of
the sample and probe, addition and incubation of the sample
and acceptor beads in the plate wells, and addition of donor
beads ... between the addition of reagents.
The broad analytical range of the assay allows quanti-
tation of large differences in the DNA-binding activity
of transcripti...
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATA
TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT
CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and
PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG
AATTCCATATGAAGAATGATCAATCTGGCTGCG
GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG
TTCCCTGTCCAGTGTTACC-3¢. ... explore the PDEs of parasites as potential
targets for antiparasitic drugs. The African trypanosome
Trypanosoma brucei is the pro...
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf
... tran-
scriptase. The cDNA was joined with the a daptor provided
by the kit (5 ¢-gcugauggcgaugaaugaacacugcguuugCUGG
CUUUGAUGAAA-3¢) using T4 DNA ligase. The modi-
fied cDNA was used as t emplate for PCR amplification.
Two ... death.
Primary structure determination of phaiodotoxin
The amino acid sequence o f the N-terminal portion of
phaiodotoxin was obtained by Edman degradatio...
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx
... plasma mem-
branes: palmitoylation of Cys immediately upstream
(2–6 residues) of farnesylated Cys of H-Ras, N-Ras
and K-Ras 4A, and a stretch of basic residues upstream
of the farnesylated Cys186 of ... Peroxidase-conju-
gated goat anti-rabbit IgG and goat anti-mouse IgG were
obtained from Wako (Osaka, Japan). Preparation of rabbit
pAbs against Alix has been described prev...
Báo cáo khoa học: A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona pptx
... Hideyoshi Sato, Chihiro Nogawa, Daishi Yamada,
Ryo Yamazaki and Takahiro Akiyama
Laboratory of Cell Biology, Faculty of Environmental Health, Azabu University, Sagamihara, Japan
Subsequent to the pioneering ... together on
drying. The surface area of the membrane may
be hydrated again and returned to the form of a
A novel acidic glycoprotein from the oyster shells...
Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc
... Hatabu, T., Kawai, S., Matsumoto, Y. &
Kano, S. (2000) Molecular cloning and characterization of a
peroxiredoxin from the human malaria parasite Plasmodium fal-
ciparum. Mol. Biochem. Parasitol. ... falciparum.This
result, and the fact that PfPlrx was amplified from a cDNA
library, indicate that the gene is transcribed and the protein
is present in blood-stage forms of...
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... Instead of
returning a long list of documents more or less re-
lated to the query parameters, the aim of a QA sys-
tem is to isolate the exact answer as accurately as
possible, and to provide the ... ids that existed in both
answers, and AllIds is the number of different ids
in both answers. We calculated the overall average
agreement ratio (Total Avg) and the averag...
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... kinds of tests on the paragraphs
in this span: a test of paragraph content, and a test
of paragraphs relative size matching. The first test
compares the paragraphs' numbering (if present).
The ... collocation occurs (both col-
location's keys occur on the same sentence, as they
are in a syntactical relation).
When parallel corpora are available, also the
tran...
Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx
... corpus (FARSDAT),
and our own team-internally generated acoustic
data. Language modeling data was also obtained
from multiple sources. The Defense Language
Institute translated approximately 600,000 ... data from English by
means of developing a sub-phonetic mapping be-
tween the two languages, as detailed in (Srini-
vasamurthy & Narayanan 2003), as well as use of
a small...