Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

... FEBS Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus Benjamin Marie 1,2 , Isabelle Zanella-Cle ´ on 3 , Marion Corneillat 4 , Michel Becchi 3 ,Ge ´ rard Alcaraz 2,4 , Laurent ... understand the molecular mechanism that controls the formation of the shell nacreous layer, we have investigated the biochemistry of Nauti...

Ngày tải lên: 22/03/2014, 16:20

... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition of donor beads ... between the addition of reagents. The broad analytical range of the assay allows quanti- tation of large differences in the DNA-binding activity of transcripti...

Ngày tải lên: 18/02/2014, 14:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... explore the PDEs of parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the pro...

Ngày tải lên: 19/02/2014, 12:20

... tran- scriptase. The cDNA was joined with the a daptor provided by the kit (5 ¢-gcugauggcgaugaaugaacacugcguuugCUGG CUUUGAUGAAA-3¢) using T4 DNA ligase. The modi- fied cDNA was used as t emplate for PCR amplification. Two ... death. Primary structure determination of phaiodotoxin The amino acid sequence o f the N-terminal portion of phaiodotoxin was obtained by Edman degradatio...

Ngày tải lên: 07/03/2014, 16:20

... plasma mem- branes: palmitoylation of Cys immediately upstream (2–6 residues) of farnesylated Cys of H-Ras, N-Ras and K-Ras 4A, and a stretch of basic residues upstream of the farnesylated Cys186 of ... Peroxidase-conju- gated goat anti-rabbit IgG and goat anti-mouse IgG were obtained from Wako (Osaka, Japan). Preparation of rabbit pAbs against Alix has been described prev...

Ngày tải lên: 16/03/2014, 06:20

... Hideyoshi Sato, Chihiro Nogawa, Daishi Yamada, Ryo Yamazaki and Takahiro Akiyama Laboratory of Cell Biology, Faculty of Environmental Health, Azabu University, Sagamihara, Japan Subsequent to the pioneering ... together on drying. The surface area of the membrane may be hydrated again and returned to the form of a A novel acidic glycoprotein from the oyster shells...

Ngày tải lên: 30/03/2014, 04:20

... Hatabu, T., Kawai, S., Matsumoto, Y. & Kano, S. (2000) Molecular cloning and characterization of a peroxiredoxin from the human malaria parasite Plasmodium fal- ciparum. Mol. Biochem. Parasitol. ... falciparum.This result, and the fact that PfPlrx was amplified from a cDNA library, indicate that the gene is transcribed and the protein is present in blood-stage forms of...

Ngày tải lên: 31/03/2014, 07:20

... Instead of returning a long list of documents more or less re- lated to the query parameters, the aim of a QA sys- tem is to isolate the exact answer as accurately as possible, and to provide the ... ids that existed in both answers, and AllIds is the number of different ids in both answers. We calculated the overall average agreement ratio (Total Avg) and the averag...

Ngày tải lên: 20/02/2014, 09:20

... kinds of tests on the paragraphs in this span: a test of paragraph content, and a test of paragraphs relative size matching. The first test compares the paragraphs' numbering (if present). The ... collocation occurs (both col- location's keys occur on the same sentence, as they are in a syntactical relation). When parallel corpora are available, also the tran...

Ngày tải lên: 22/02/2014, 02:20

... corpus (FARSDAT), and our own team-internally generated acoustic data. Language modeling data was also obtained from multiple sources. The Defense Language Institute translated approximately 600,000 ... data from English by means of developing a sub-phonetic mapping be- tween the two languages, as detailed in (Srini- vasamurthy & Narayanan 2003), as well as use of a small...

Ngày tải lên: 08/03/2014, 04:22