Health-related quality of life of elderly living in nursing home and homes in a district of Iran: Implications for policy makers pdf
... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAABMgAAAYwCAIAAAAI8uQFAAAACXBIWXMAABYlAAAWJQFJUiTwAAAgAElEQVR42uzdZ3wUZeLA8SfJ0hIEAwlWiAUJTU6khSqgSEcERBQbIiL2gljOwikKAipWBERUTk8QsYAgNlQ6nHKHVBE1gChsUClLc5P8X+xdLoecp/c5/3r6/X72RZjMzM7uvMjnxzPzTFJhYWEAAACA/1SyrwAAAABhCQAAgLAEAABAWAIAACAsAQAAQFgCAAAgLAEAABCWAAAACEsAAAAQlgAAAAhLAAAAhCUAAADCEgAAAIQlAAAAwhIAAABhCQAAgLAEAAAAYQkAAICwBAAAQFgCAAAgLAEA...
Ngày tải lên: 22/03/2014, 14:20
... social classes in Zimbabwe in general, and in the elderly in institutions and homes in particular. Race is no longer a deciding factor in most aspects of health status (J' access to care, ... require nursing and care, and grandchildren will need to be cared for. Polky suggestions An alternative approach to shelter and accommodation for elderly Africa...
Ngày tải lên: 14/02/2014, 07:20
... Matrine inhibits invasiveness and metastasis of human malignant melanoma cell line A3 75 in vitro. Int J Dermatol. 2008; 47:448-56. 7. Gabizon AA, Shmeeda H, Zalipsky S. Pros and cons of the ... LM. A targeted approach for antiangiogenic therapy of metastatic human colon cancer. Am Surg. 2003; 69:3-10. 13. Nakamura T, Sato K, Hamada H. Effective gene transfer to human me...
Ngày tải lên: 26/10/2012, 08:57
Impact of pH on Anaerobic Substrate Uptake by PAOs and GAOs in an EBPR Activated Sludge Process Analyzed by MAR-FISH
... probe (a mixture of CCGTCATCTACWCAGGGTATTAAC, CCCTCTGCCAAACTCCAG, and GTTAGCTACGGCACTAAAAGG) (Crocetti et al., 2000) targeting at Candidatus ‘Accumulibacter phosphatis’, one of the PAOs; GB ... on acetate uptake by PAOs and GAOs The profiles of pH, acetate uptake, and phosphate release observed in the cold experiments are shown in Figs. 2, 3 and 4. In all cases, ace...
Ngày tải lên: 05/09/2013, 09:38
Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss
... was incubated for 3 days, and then the photograph of the moss was taken again. All incubations were performed under aseptic condition. The area covered by the moss was measured by an image ... in the last decades. Estimations of heavy metal toxicity and accumulation in heavy metal tolerant plants are necessary in order to apply the phytoremediation for heavy metal re...
Ngày tải lên: 05/09/2013, 10:15
Radioactive waste in the Barents and Kara Seas - Russian implementation of the global dumping regime
... military handling of radioactive waste was becoming an international issue. A former radiation safety engineer in the Murmansk Shipping Company, Andrey Zolotkov, who was also an activist in the ... financial backing, inadequate informational basis for making environmental decisions and poorlydefined inter- nal str uctures. 97 In contrast, the Ministryof Atomic Power appears gradua...
Ngày tải lên: 01/11/2013, 09:20
Contrative analysis of cohesive devices in english texts and those in vietnamese ones
... Contrastive analysis of Cohesive devices in English texts and those in Vietnamese ones Acknowledgements On completion of this granduation paper, I am very grateful to Department of Foreign Languages ... - 41 A1 English Vinh University Contrastive analysis of Cohesive devices in English texts and those in Vietnamese ones Table of contents Page Acknowledgements Table of...
Ngày tải lên: 12/12/2013, 00:03
Tài liệu Negotiations in project sales and delivery process: An application of negotiation analysis pdf
... chapter, most negotiations actually present a tension between creating joint value, i.e. increasing the payoffs to all parties, and claiming individual value, i.e. increasing the payoffs to a ... a fair outcome: fairness standard and a fair procedure. The specific fairness standards that are applicable in a given situation vary widely from one class of negotiation to an...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx
... Cells of the indicated strains were grown to stationary phase and then lipids were extracted and separated by TLC. The amount of SE of the wildtype strain was set at 100%. Data are mean values of ... whether Are1p and Are2p have a role in cell polarity. Bud site selection, mating and filamentous growth was normal in cells lacking ARE1 and ARE2 (data not shown), but apic...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx
... donor agencies are to generate and use performance information for accountability reporting to external stakeholder audiences and for internal management learning and decision-making. Most agencies’ ... states and non-governmental organizations were leading to increasingly diverse programs and complicating evaluation approaches and issues. To meet anticipated increases in de...
Ngày tải lên: 21/02/2014, 11:20