Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... HierarchyProcess,VolumeI,Pittsburgh, PA,RWSPublications,1996.  VNUJournal of Science,EarthSciences24(2008)66‐78 66 Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province NguyenTienGiang 1, *,TranAnhPhuong 1 ,TranNgocAnh 1 , NguyenThanhSon 1 ,NguyenTruongKhoa...

Ngày tải lên: 22/03/2014, 12:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and p...

Ngày tải lên: 19/02/2014, 17:20

... A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD. Galactose administration increased ... (nm to lm) and stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galac...

Ngày tải lên: 18/02/2014, 16:20

... rapid analysis of libraries of protein variants. Phage- display has proved to be a powerful tool for analyzing protein stability due to the large library size and the robustness of the phage particle ... to the labor-intensive process of generating and characterizing individual mutant proteins, these combinatorial approaches offer the important advantage of s...

Ngày tải lên: 19/02/2014, 12:20

... final model. Linear discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass ... greatest part of the original data information. In the second part of our work, we focused on the biochemical information available i n infrared s pectra, and we found t...

Ngày tải lên: 21/02/2014, 03:20

... goal: A, u.¬subst (A, u) ∧ A, u.¬mustadjoin (A, u). We can then send the actions and the initial state and goal specifications to any off -the- shelf planner and obtain the plan in Fig. 3. The straight arrows in the ... every action that has them as their precondition. There may be multiple action instances in the plan that introduce the same atom canadjoin (A, u). In...

Ngày tải lên: 20/02/2014, 12:20

... investigated in this study. Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A (Kyoto, Japan) equipped with flame ionization ... higher than that obtained at the end of linear phase during normal nutrition. The drying temperature during lipid extraction from algal biomass was found to affect th...

Ngày tải lên: 21/02/2014, 10:20

... investigated in this study. Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A (Kyoto, Japan) equipped with flame ionization ... higher than that obtained at the end of linear phase during normal nutrition. The drying temperature during lipid extraction from algal biomass was found to affect th...

Ngày tải lên: 21/02/2014, 10:20

... activation of kinases such as Akt has been shown to increase HSF1 activity. Enhanced Ras maturation by heat stress was associated with a heightened activation of extra- cellular signal-regulated ... sufficient to initi- ate signal transduction [33], i.e. changes in lipid dynam- ics in the plasma membrane can serve as a link between mechanical force and chemical signaling....

Ngày tải lên: 07/03/2014, 12:20

... target and nontarget cytosine and central thymine residues. Study of the DNA stability using thermal dena- turation of 2-pyrimidinone containing duplexes pointed to the in uence of the bases adjacent ... proximity of the cofactor [2]. Several cytosine analogues, 5-fluorocytosine (FC), 5-azacytosine (AzaC) and 2-pyrimidinone (2P), have been reported as mechanism-based inh...

Ngày tải lên: 07/03/2014, 15:20