Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc

... in a Tertiary Care Hospital in India Madhutandra Sarkar 1 *, Hiralal Konar 2 , DK Raut 3 of the cervical cancer cases occur in the developing countries (Sankaranarayanan & Ferlay, 2006) and ... years while that for ovarian carcinoma 46.4 years and endometrial carcinoma 56.0 years. A study done in Larkana, Pakistan (Siyal et al., 1999) had reported that the a...

Ngày tải lên: 22/03/2014, 11:20

... application interval was 31.4 days, mean referral interval was 22.1 days, mean diagnosis interval was 3.3 days, and mean initiation of treatment interval was 1.4 days. Patient delay was present in 34.8 ... and three patients (50.5%) had delays in diagnosis and 51 patients (25%) had delays in initiation of treatment. The mean (95%, CI) diagnosis interval was 3.7 days (2.5 to 4....

Ngày tải lên: 22/03/2014, 18:20

... Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India Madhutandra Sarkar 1, 2* , Hiralal Konar 3 , DK Raut 4 Madhutandra Sarkar et al Asian Pacic Journal of Cancer Prevention, ... presenting symptom among the patients of ovarian cancer in a hospital of Nigeria. Sultana and Kiyani (2005) in their study conducted in a hospital of...

Ngày tải lên: 28/03/2014, 14:20

... determine the knowledge, attitudes and practices of specialist physicians in a tertiary care hospital as to: a. their idea of the magnitude of TB problem in the Philippines b. their opinion of the ... tertiary care hospital as St. Luke’s realize the magnitude of TB problem in the country. However, the majority does not favorably rate the National...

Ngày tải lên: 15/03/2014, 03:20

... fits the data. It indicates the amount of the relationship between the variables that remains unex- plained by a model; the larger the value, the poorer the model fits the data. As a rule of thumb, ... Reference Standards Using Data from a Tertiary Care Centre in Rwanda Mugabekazi Julie 1 , Boelaert Marleen 2 , Sarushi Joseph 1 , Seruyange Eric 1 , Basinga P...

Ngày tải lên: 22/03/2014, 18:20

... 4038–4044] have been interpreted as implying channelling of arginine between argininosuccinate lyase and arginase in permeabi- lized hepatocytes. To investigate this interpretation further, a mathematical ... urea, argininosuccinate and arginine. Simulating the effect of the addition of 1 m M unlabelled arginine on the distribution of radioactivity in cytoplasmic intermedi...

Ngày tải lên: 08/03/2014, 08:20

... 3, Matsuyama 790-8577, Japan ABSTRACT Matsuyama region, located in Shikoku Island, Japan faces the Seto Inland Sea on the west, where the annual rainfall is relatively less than in the other ... the area around the Seto Inland Sea has a small amount of rainfall with a comparatively warm climate, the cultivation of citrus fruits is popular. The ratio of the...

Ngày tải lên: 05/09/2013, 10:17

... sites in bold type) A IHinfor CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS) IEcorev CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) B IEcofor ... GTTGAATTCTCGTGTTTATGAGGG (located upstream of furS and beginning at the 3¢-end of binding site I) IPstrev GGAGCTGCAGCCCACGCGATCGCG (located downstream of the start codon of...

Ngày tải lên: 07/03/2014, 10:20

...

Ngày tải lên: 14/03/2014, 13:20

... uveitis cases. It has bee n estimated to be under 1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and 16% in Saudi Arabia [10]. A Southeast Asian neighbor, Thailand, reported a 2.2% systemic ... prospective study in 2002 [8]. Biswas and Badrinath examined 2,010 eyes of pulmonary TB patients and found a 1.39% ocular involvement [9]. Other studies include data abou...

Ngày tải lên: 15/03/2014, 03:20