Electrochemical Oxidation of Cysteine at a Film Gold Modified Carbon Fiber Microelectrode Its Application in a Flow—Through Voltammetric Sensor

Electrochemical Oxidation of Cysteine at a Film Gold Modified Carbon Fiber Microelectrode Its Application in   a Flow—Through Voltammetric Sensor

Electrochemical Oxidation of Cysteine at a Film Gold Modified Carbon Fiber Microelectrode Its Application in a Flow—Through Voltammetric Sensor

. www.mdpi.com/journal/sensors Article Electrochemical Oxidation of Cysteine at a Film Gold Modified Carbon Fiber Microelectrode Its Application in a Flow—Through Voltammetric Sensor Lai-Hao Wang * and Wen-Shiuan. peak height was calculated using a chromatogram data integrator (Scientific Information Service Corp., Davis, CA, USA). The samples of L -cysteine and hydrogen tetrachloroaurate(...

Ngày tải lên: 21/03/2014, 12:18

16 371 0
Báo cáo hóa học: " Catalytic ozone oxidation of benzene at low temperature over MnOx/Al-SBA-16 catalyst" pdf

Báo cáo hóa học: " Catalytic ozone oxidation of benzene at low temperature over MnOx/Al-SBA-16 catalyst" pdf

. the textural properties of Al-SBA-16 cata- lysts i mpregnated with Mn nitrate and Mn acetate. Al- SBA-16-MN15% had a greater BET surface area than Al-SBA-16-MA15%. The XRD pattern of the synthesized. (ethanol) in a rotary evaporator, the sample was calcined in air at 550°C. The Al-incorporated sample is hereafter referred to as Al-SBA-16. The amount of Mn impregnated using Mn(NO 3 ) 2 (98%, Aldr...

Ngày tải lên: 20/06/2014, 23:20

5 339 0
A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation

A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation

. of textual material in one language (Source language) by equivalent material in another language (Target Language)”. According to B. Hatim and I. Mason in “ Discourse and the Translator” (1990,. discussion of finding is carried out in order to find out the ways of translating of non – finite clauses. Finally, giving some implications on teaching, learning and translating non – finite clau...

Ngày tải lên: 26/11/2013, 13:19

13 1K 3
Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc

Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc

. enzyme binds FAD, NAD or NADP. In general, the presence of a negatively charged residue indicates that FAD or NAD is the preferred cofactor [5], due to the steric hindrance to accommodate the additional 2¢-phosphate. Thermococcus kodakaraensis, Candida glabrata and Yarrowia lipolytica, the Ross- mann proteins are two to three times more redundant than proteins in general. The redundancy among eu...

Ngày tải lên: 23/03/2014, 10:21

8 481 0
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

. of Pt or Pt-D, as well as by varying Pt or Pt-D concentrations at satur- ating NADP concentrations (data not shown). The kinetic parameters of each data set were obtained from fitting the data. University of Illinois at Urbana-Champaign, Urbana, IL, USA 2 Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, IL, USA 3 Department of Biochemistry,....

Ngày tải lên: 23/03/2014, 15:20

12 368 0
Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

. Comput- ing Research Laboratory, New Mexico State University, Las Cruces NM. Yamanashi, Masa-aki. (1987). Metonymic interpretation and associative processes in natural language. In Language and. that the main factors for treating metonymy correctly in a multil- ingual machine translation system are 1) its universality, which can be a guideline for the analysis component, 2) language. s...

Ngày tải lên: 23/03/2014, 20:20

3 454 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

. factor analysis was con- ducted in SPSS version 15 on job satisfaction data at 6 and 18 months using principal component analysis with var- imax rotation and Kaiser normalization to ascertain whether. at 3 years. An analysis of NHS Path model of job satisfaction, future intentions and nursing at 18 months and 3 yearsFigure 1 Path model of job satisfaction, future intentions and nursing at 18. wo...

Ngày tải lên: 18/06/2014, 17:20

12 530 0
báo cáo hóa học: " Inhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia" docx

báo cáo hóa học: " Inhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia" docx

. injury in rats via down-regulation of the inflammatory mediators NF-κB and iNOS. Thus, inhibit- ing the 5-LOX/NF-κB pathway holds therapeutic potential to attenuate inflammation-mediated brain. NF-kappaB is activated and promotes cell death in focal cerebral ischemia. Nat Med 1999, 5:554-559. 13. Rothwarf DM, Karin M: The NF-kappa B activation pathway: a paradigm in information transfer. Access...

Ngày tải lên: 19/06/2014, 22:20

13 474 0
Báo cáo hóa học: " Enhancements of thermal conductivities with Cu, CuO, and carbon nanotube nanofluids and application of MWNT/water nanofluid on a water chiller syste" docx

Báo cáo hóa học: " Enhancements of thermal conductivities with Cu, CuO, and carbon nanotube nanofluids and application of MWNT/water nanofluid on a water chiller syste" docx

. the nanofluid (MWNT/water nanofluid) was used for testing. Ranges of the flow rate are from 60 to 140 L/min at inter val of 20 L/min. The inlet tempera- ture of cooling water was maintained at. capacity rate between water base fluid and MWNT/water nanofluid, one can see that the cooling capacity of MWNT/water nanofluid is higher than that of water base fluid over the entire test- ing. water base...

Ngày tải lên: 21/06/2014, 04:20

13 393 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

. phosphatis’ CTGGAGTTTGGCAGAGGG This study PAO846r Candidatus ‘Accumulibacter phosphatis’ GTTAGCTACGGCACTAAAAGG This study PAO462 Candidatus ‘Accumulibacter phosphatis’ CCGTCATCTACWCAGGGTATTAAC Crocetti. Quantification of Candidatus ‘Accumulibacter phosphatis’ in Activated sludge Candidatus ‘Accumulibacter phosphatis’ in activated sludge samples was quantified using the quantitative PCR and. C...

Ngày tải lên: 05/09/2013, 09:38

7 720 0
Từ khóa:
w