effects of dimensions on the sensitivity of a conducting polymer microwire sensor
... (i.e., the volume of the chamber) and the density of air at room temperature. The concentration of the methanol was calculated from the ratio between the mass of methanol and that of air inside the ... indicates how large the sensor response is to a particular concentration, and is used as a measure of the sensitivity of the corresponding sensor....
Ngày tải lên: 19/03/2014, 16:48
... and recruitment and retention programs of the armed forces. Accurate data on the relationship between performance on the one hand and ability, experience, and training on the other would allow ... technician; ”technical” positions, including aviation machinist’s mate, aviation structural mechanic, aviation ordnanceman, aviation equipment support technician, and aviation su...
Ngày tải lên: 17/02/2014, 22:20
... Malaysia consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National ... central part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia and t...
Ngày tải lên: 06/03/2014, 15:21
Báo cáo y học: "Effect of antibodies on the expression of Plasmodium falciparum circumsporozoite protein gene"
... falciparum 3D7 clone. Concentration of DNA was determined by spectrophotometric analysis of optical density at 260nm (GeneQuant, Pharmacia) and standard DNA solutions were prepared. A standard ... the mean number of parasites when treated with 1μg mAb/ml. Anti-CSP-mAb had contradictory effect depending on concentration and although mAb at lower concentration seems to have...
Ngày tải lên: 02/11/2012, 10:14
The Effect of Aesthetic on the Usability of Data Visualization pdf
... visualization technique with the lowest aggregate aesthetic rank, averaged the highest rate of task abandonment and was among the lowest in latency of erroneous response. More than half of all participants ... mean of aesthetic rank was calculated for each of the 11 visualizations, as illustrated in Figure 4. The confidence interval of .05% determined the validity...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Effect of heliquinomycin on the activity of human minichromosome maintenance 4/6/7 helicase pdf
... displacement activity of replication protein A (RPA), and on the RNA priming and DNA poly- merization activities of the DNA polymerase -a/ primase complex. The results indicated that, among all the enzymes ... at an IC 50 value of 25 lm. The DNA polymerization activity of the DNA polymerase -a/ primase complex was measured using activated DNA as a template and a p...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: The influence of cholesterol on the interaction of HIV gp41 membrane proximal region-derived peptides with lipid bilayers potx
... which has a + 2 net formal charge, and the negatively charged lipid. For MPRP-I, the partition constant increase was not as high and in the case of MPRP-S the partition constant remained unchanged relative ... presence of (a) MPRP-C, (b) MPRP-I and (c) MPRP-S. The spectra were obtained by subtracting the excitation spectrum before the addition of peptides from the exci...
Ngày tải lên: 23/03/2014, 07:20
RCUK Policy and Code of Conduct on the Governance of Good Research Conduct pptx
... appropriate. • The person against whom allegations are made should be given details of the allegations in writing, the nature of the evidence against them, and be given reasonable time and opportunity ... each of the following: Fabrication This includes the creation of false data or other aspects of research, including documentation and participant consent. Falsification...
Ngày tải lên: 24/03/2014, 02:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* ... effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations Mousumi Banerjee 1 , Hemalatha...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... NRG-5¢_for NRG-Beta_rev TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC 677 GAPDH GAPDH_for GAPDH_rev GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT 450 Fig. 2. Proteolytical processing of APP and NRG-1 in U373 ... NRG-jD_for NRG-TM_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC Approximately 200 (depending on isoform) Immunoglobulin domain (type I and II) NRG-IG_for NRG-TM_rev GCCAGGGAAGT...
Ngày tải lên: 16/03/2014, 04:20