Báo cáo Y học: The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components doc
... 1661 The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components Stefan ... Mo- contain- ing nitrogenase from the same organism, showed that: (a) the Fe nitrogenase components can indeed be isolated and puri...
Ngày tải lên: 18/03/2014, 01:20
Ngày tải lên: 25/10/2012, 10:02
... observations seen in the study of Fumeaux et al. (2002) demonstrating that a modification of HLA- DR, post-translationally, may be one mechanism responsible for the low surface expression of monocyte ... confocal imaging to allow visualisation of sections through the cell to observe surface and intracellular staining. Figures 3a- d show the intracellular and surface...
Ngày tải lên: 03/11/2012, 09:57
Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"
... feature allows HA to maintain conformational stiffness and to retain water. One gram of HA can bind up to 6 L of water [6]. As a physical background material, it has functions in space filling, ... and the presence of plaque was registred mesially, buccally, distally, and lingually. Data were obtained at baseline before treatment and at 10 days, and 6,9, and 24 mon...
Ngày tải lên: 03/11/2012, 11:35
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx
... spectra of isolated amino acids as model compounds and information on contributions from the secondary structure from infrared absorbance spectra and the deconvolution of the amide-I region. A particular ... geranyl side chain expected from heme a and a 3 . In addition to the signals of the hemes, the reorgan- ization of the polypeptide backbone an...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... membrane-associated mucins are very large and seem to share four common domains: a short cytoplasmic domain, a transmembrane domain, EGF-like domains and the large O-glycosylated region with an amino-acid sequence ... clone was obtained and named BAC4. Fig. 1. Muc4 cDNA (A) and genomic (B) cloning strategy, and protein domains organization (C). (A, B) Several cDNA clones and...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand ... H., Miyata, T., Mayanagi, K., Yamada, K., Morikawa, K & S hinagawa, H. (2001) A unique b-hairpin pro- truding from AAA + ATPase domain of RuvB motor protei...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: Purification, characterization and subunits identification of the diol dehydratase of Lactobacillus collinoides pot
... purification, enzymatic characterization and analysis of the composition of the diol dehydratase of L. collinoides. MATERIALS AND METHODS Bacteria and culture conditions The lactic acid bacterium ... nondenaturing conditions and revealed one main band and two weaker bands. Their dissociation by SDS in the second dimension showed that the main band was released into...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot
... analog possesses a weak antagonistic activity. The aim of the present study was to synthesize and characterize cyclic analogs of OP and [ D-Leu5]OP. On- resin homodetic backbone cyclization of OP ... secondary structure of the cyclic OP analogs by two-dimensional 1 H-NMR and molecular dynamic simulation, and we have investigated the biological activity of thes...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: Changes in ultrastructure and the occurrence of permeability transition in mitochondria during rat liver regeneration ppt
... Italy; 2 Department of Zoology, Laboratory of Histology and Comparative Anatomy, University of Bari, Italy; 3 Center for the Study of Mitochondria and Energy Metabolism (CNR) Bari, Italy Mitochondrial ... cytosolic AAT was stable, there was a thermal instability of mitochondrial AAT at 70 °C [22]. The activity of mitochondrial AAT was taken as the difference betwee...
Ngày tải lên: 24/03/2014, 04:21