Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stres

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

... 2002 ACa 2+ /CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter Sona Pandey*, Shiv B. Tiwari † , Wricha Tyagi, Mali K. Reddy, Kailash ... and DNA GMSA with pea nuclear proteins fractionated by immuno -a nity chromatography. (A) Protein fractions eluted from kinase antibody a nity c...

Ngày tải lên : 18/03/2014, 01:20

12
365
0

Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

... accelerated by okadaic acid, a protein phosphatase inhibitor. Incorporation of 32 P into a 53-kDa protein, which was judged to be TPH based on autoradiography and Western blot analysis using anti-TPH serum ... [( L - 3-trans-ethoxycarbonyloxirane-2-carbonyl)- L -leucine(3-meth- ylbutyl)amide] were purchased from Peptide Institute (Osaka), lactacystin from Kyowa Medex (Tokyo), o...

Ngày tải lên : 08/03/2014, 16:20

9
404
0

Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

... pravastatin is open hydroxyl-acid so that its hydrophilicity is markedly higher than that of other statins. The oral bioavailability of this statin is low due to degradation in the stomach ... of Pharmaceutics, College of Pharmacy, King Saud University, P.O. Box 2457, Riyadh 11451, Saudi Arabia  Corresponding author: Fars K. Alanazi, Kayyali Chair for Pharmaceutical Indust...

Ngày tải lên : 25/10/2012, 11:10

9
829
0

Báo cáo Y học: Matrilysin (matrix metalloprotease-7) cleaves membrane-bound annexin II and enhances binding of tissue-type plasminogen activator to cancer cell surfaces docx

... antibody against annexin II and rabbit polyclonal antibody against annexin II from Santa Cruz (Santa Cruz, CA, USA); and goat polyclonal antibody against p11 from R&D systems (Minneapolis, MN, ... N-(R)-[2-(hydrox- yaminocarbonyl)-methyl]-4-methylpentanoyl-l-naphthyl- alanyl-l-alanine-2-aminoethyl amide (TAPI-1), but not by a mixture of inhibitors for serine, aspartic and cyst...

Ngày tải lên : 17/03/2014, 17:20

14
419
0

Báo cáo y học: "Efficacy of Sirolimus-Eluting Stents Compared With Paclitaxel-Eluting Stents in an Unselected Population With Coronary Artery Disease: 24-Month Outcomes of Patients in a Prospective Non-randomized Registry in Southern Turkey&

... institution- al and departmental resources. Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major ad- verse ... Abbreviations: CABG, coronary artery bypass graft; HDL, high-density lipoprotein; LDL, low-density lipoprotein; MI, myocardial infarc- tion; SAP, stable angina pectoris; USAP,...

Ngày tải lên : 26/10/2012, 08:57

6
627
0

Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

... In this context, activation of the mitogen-activated protein kinase (MAPK)/extracellular signal -regulated kinase (ERK) signaling pathway has been found fundamental in transducing extracellular ... [1]. Interestingly, a MAPK-related pathway has also been reported to be involved in neoplastic transformation [2], and an increase in MAPK expression and activity reported i...

Ngày tải lên : 21/02/2014, 01:21

10
703
0

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... The fraction containing the pure peptide was lyophilized twice and the purity assessed by a MALDI-TOF analysis using a Hewlett Packard G202 5A LD-TOF system mass spectro- meter and a- cyano-4-hydroxycinnamic ... strongly hydrophobic side chains; this feature has been aptly described by Rajan et al. as a Teﬂon coating that can surround a helix [16] in the case of a mixture...

Ngày tải lên : 08/03/2014, 09:20

7
624
0

Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deﬁcient strain of Saccharomyces cerevisiae and study of its complementation pdf

... vector. Table 1. Alignments of the A. acetabulum six proteolipid subunits and yeast three subunits (% identity). AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p AACEVAPD1 ... preparation of recombinants in yeast expression vector In the case of AACEVAPD1, 3 and 6, TAA is used as an Acetabularia-speciﬁc codon usage (translated as Gln). Conversion of T...

Ngày tải lên : 08/03/2014, 23:20

8
391
0

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (steﬁn A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse ... cystatin A for the binding of cysteine proteases, in particular cathepsin B. The role of this loop is comparable to that of the corresponding loops of cystatin B and fa...

Ngày tải lên : 17/03/2014, 10:20

10
533
0

Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

... extracytoplasmic side. This pathway was predicted by identifying internal cavities lined by polar residues, an original approach that we validate by showing that it is capable of identifying the ... the Tyr694 to Gly m utant displayed a strong resistance towards inhibition by vanadate. Interestingly, Tyr694Ala mutant resulted in a presumably uncoupled enzyme, although the low r...

Ngày tải lên : 23/03/2014, 21:20

13
514
0