Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... 138
tctgtttcagATCAG CTTTGgtatgaatct 17 3067 1
Human 17 138
tgtgtttcagATCAG CTTTGgtaggactat 17 1806 1
Mouse 18 182
ctctggacagAAAAC TTGAGgtgagtagtg 18 838 0
Human 18 182
cccggggcagAGAAT TGGAGgtgagtgttg ... 180
tgttcctcagGCATC CCCAGgtgatacctc 9 202 1
Human 9 180
ccgacctcagGCCTC CATAGgtgacacctc 9 145 1
Mouse 10 117
ctctttgcagGTTGG GTTTGgtaagtatct 10 681 1
Human 10 114/126
d
cttgtttcagGTCG...
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... RAMIG
antibody at 37 °C, for 30 min. The cells were then fixed
with formaldehyde, b locked with isotype control antibody
and stained with the fluorescent antibody against the other
protein, on ice. The ... & Dautry-
Varsat, A. (1995) Endocytosis of interleukin 2 receptors in human
T l ymphocytes: distinct intracellular localization and fate of the
receptor alpha, b...
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... of
one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA
AGATGTCCTAGCAATGTAATCGTCTATGACGTT),
2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG
GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA
CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG
ACCC), ... protein. The
results suggest that the m odified pin in uences the a bility to
bind duplex DNA and is consistent with observations by
Ingleston et al. [12] showing that mutations in E...
Báo cáo Y học: Domain organization, folding and stability of bacteriophage T4 fibritin, a segmented coiled-coil protein docx
... was
observed. The assignment of the 330 K transition is evident
from the loss of a helicity at this temperature and changes in
the magnitude of the accompanying enthalpy. The ratio o f
the van t Hoff enthalpy ... The singularity a nd pro-
portionality of that transition are consistent with the
thermal unfolding of a uniform do main. By varying the
ionic stre...
Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc
... cellooligosaccharides and p-nitrophenyl
b-glucopyranoside.
Subsite stucture of the active center
For determination of the active center subsite structure the
kinetic parameters K
m
and V
max
of the hydrolytic ... important thing is
regularity of a value for the intrinsic rate constant K
int
.
Accordingly, the substrate binding affinity becomes the sum
of the affini...
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... ribozyme in Mn
2+
is that binding of
the cosubstrate to its site induces a conformational
change in the RNA that inhibits Mn
2+
binding at
another inhibitory site(s). It may be relevant that
in vitro-evolved ... ground-state structure of InDG
b
is that
the ribozyme might undergo a transient internalization
of P7, J8 ⁄ 7 and J6 ⁄ 7 after binding GMP to start the
reaction....
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... of the eRF1 mutants stimulated eRF3
GTPase activity nearly identically to that of the wild-
type protein (Table S2). These results indicate that the
C-domain is able to change the efficiency of ... results of the GTPase
assays, which showed that mutations in the minido-
main of eRF1 did not change the GTPase activity of
eRF3.
The minidomain in the crystal stru...
Báo cáo khóa học: Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae pot
... (5¢-GGGCCGGC
GGCCATGGCTAAACAGGAATTCTCGGTTAAAGG
TATGTCTTGCAAC-3¢); copz-ap2, (5¢-GATACGACC
AACAGCTTCTTCGATACGAGCAACGCAGTGGT
TGCAAGACATACCTTTAAC-3¢); copz-p3, (5¢-GAA
GCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTT
AAAGTTCAGCTGAAGAAAGAAAAG-3¢); ... was
established within 2 min of the addition of the metal.
The data corresponding to the titration of EhCopZ with
cadmium were fitted using either t...
Báo cáo Y học: ATP stimulates MDM2-mediated inhibition of the DNA-binding function of E2F1 pot
... Geldanamycin and 17-
allylamino demethoxygeldanamycin that target the
nucleotide-binding site of HSP90 can alter the activity
of the protein, change its conformation, and sensitize
cells to death ... MDM2 to drive ubiqui-
tination of p53: a coordinated interaction of the N-ter-
minus of MDM2 with the N-terminus of p53, and an
interaction of the acid domain of...
Báo cáo Y học: Novel regulatory regions found downstream of the rat B29/Ig-b gene docx
... resulted compared with the activity of the SV-40
promoter alone. The region containing +4.4a to +4.6b
showed twice the activity of the SV-P control and essentially
the same as that of the SV-40 enhancer ... protected by Y3 nuclear
extract in which the consensus binding site for the OCT
family was present. Deletion of the footprinted region
reduced enhancing ac...
Từ khóa:
- báo cáo y học
- báo cáo y học cổ truyền
- mẫu báo cáo y học cổ truyền
- bao cao y hoc colchicin
- phan ban luan trong bao cao y hoc co truyen
- strengths and weaknesses of the case study method in psychology
- reasons and origins of the civil rights movement in the usa
- strengths and weaknesses of the nature nurture debate in psychology