... 138 tctgtttcagATCAG CTTTGgtatgaatct 17 3067 1 Human 17 138 tgtgtttcagATCAG CTTTGgtaggactat 17 1806 1 Mouse 18 182 ctctggacagAAAAC TTGAGgtgagtagtg 18 838 0 Human 18 182 cccggggcagAGAAT TGGAGgtgagtgttg ... 180 tgttcctcagGCATC CCCAGgtgatacctc 9 202 1 Human 9 180 ccgacctcagGCCTC CATAGgtgacacctc 9 145 1 Mouse 10 117 ctctttgcagGTTGG GTTTGgtaagtatct 10 681 1 Human 10 114/126 d cttgtttcagGTCG...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... RAMIG antibody at 37 °C, for 30 min. The cells were then fixed with formaldehyde, b locked with isotype control antibody and stained with the fluorescent antibody against the other protein, on ice. The ... & Dautry- Varsat, A. (1995) Endocytosis of interleukin 2 receptors in human T l ymphocytes: distinct intracellular localization and fate of the receptor alpha, b...
Ngày tải lên: 17/03/2014, 23:20
... of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), ... protein. The results suggest that the m odified pin in uences the a bility to bind duplex DNA and is consistent with observations by Ingleston et al. [12] showing that mutations in E...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: Domain organization, folding and stability of bacteriophage T4 fibritin, a segmented coiled-coil protein docx
... was observed. The assignment of the 330 K transition is evident from the loss of a helicity at this temperature and changes in the magnitude of the accompanying enthalpy. The ratio o f the van t Hoff enthalpy ... The singularity a nd pro- portionality of that transition are consistent with the thermal unfolding of a uniform do main. By varying the ionic stre...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc
... cellooligosaccharides and p-nitrophenyl b-glucopyranoside. Subsite stucture of the active center For determination of the active center subsite structure the kinetic parameters K m and V max of the hydrolytic ... important thing is regularity of a value for the intrinsic rate constant K int . Accordingly, the substrate binding affinity becomes the sum of the affini...
Ngày tải lên: 24/03/2014, 04:21
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... ribozyme in Mn 2+ is that binding of the cosubstrate to its site induces a conformational change in the RNA that inhibits Mn 2+ binding at another inhibitory site(s). It may be relevant that in vitro-evolved ... ground-state structure of InDG b is that the ribozyme might undergo a transient internalization of P7, J8 ⁄ 7 and J6 ⁄ 7 after binding GMP to start the reaction....
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... of the eRF1 mutants stimulated eRF3 GTPase activity nearly identically to that of the wild- type protein (Table S2). These results indicate that the C-domain is able to change the efficiency of ... results of the GTPase assays, which showed that mutations in the minido- main of eRF1 did not change the GTPase activity of eRF3. The minidomain in the crystal stru...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khóa học: Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae pot
... (5¢-GGGCCGGC GGCCATGGCTAAACAGGAATTCTCGGTTAAAGG TATGTCTTGCAAC-3¢); copz-ap2, (5¢-GATACGACC AACAGCTTCTTCGATACGAGCAACGCAGTGGT TGCAAGACATACCTTTAAC-3¢); copz-p3, (5¢-GAA GCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTT AAAGTTCAGCTGAAGAAAGAAAAG-3¢); ... was established within 2 min of the addition of the metal. The data corresponding to the titration of EhCopZ with cadmium were fitted using either t...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo Y học: ATP stimulates MDM2-mediated inhibition of the DNA-binding function of E2F1 pot
... Geldanamycin and 17- allylamino demethoxygeldanamycin that target the nucleotide-binding site of HSP90 can alter the activity of the protein, change its conformation, and sensitize cells to death ... MDM2 to drive ubiqui- tination of p53: a coordinated interaction of the N-ter- minus of MDM2 with the N-terminus of p53, and an interaction of the acid domain of...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: Novel regulatory regions found downstream of the rat B29/Ig-b gene docx
... resulted compared with the activity of the SV-40 promoter alone. The region containing +4.4a to +4.6b showed twice the activity of the SV-P control and essentially the same as that of the SV-40 enhancer ... protected by Y3 nuclear extract in which the consensus binding site for the OCT family was present. Deletion of the footprinted region reduced enhancing ac...
Ngày tải lên: 24/03/2014, 03:21