Báo cáo Y học: Unfolding and refolding studies of frutalin, a tetrameric D-galactose binding lectin doc

... Unfolding and refolding studies of frutalin, a tetrameric D -galactose binding lectin Patricia T. Campana 1 , Derminda I. Moraes 1 , Ana C. O. Monteiro-Moreira 1,2 and Leila M. Beltramini 1 1 Instituto ... recombinant human promatrilysin [23]. Figure 3 shows the CD spectra for Th and Ch of the Nfrutalin, Ufrutalin, Rfrutalin and Mfrutalin forms. Nfrut- alin had a...

Ngày tải lên: 17/03/2014, 23:20

... sense 5¢-ATTTCTGTATTC AAGCTGGAGGCAGAGCCGTG AT-3¢,antisense5¢-CTGCCTCCAGC TTGAATACAG AAATG-3¢; N424D, sense 5¢-AGATTTGGG GATAC TTCATCTAGCTCAATTT-3¢,antisense5¢-AGATGAAGT ATCCCCAAATCTATGTAACG-3¢; ... recombinant FAE1 KCS was active with several acyl-CoA substrates, with highest activity towards saturated and monounsaturated C16 and C18. In the absence of an acyl-CoA substrate, FAE1 KCS wa...

Ngày tải lên: 24/03/2014, 03:21

... contributions All authors made substantial contributions to conception and design, and to the analysis and interpretation of the data. TRM and GWC handled acquisition of data. All authors contributed ... study include evaluation of a large number of patients participating in an RA registry at 11 VHA medical centers. All patients had rheumatologist-confirmed RA and well-...

Ngày tải lên: 25/10/2012, 10:45

... by real-time PCR analysis of RNA for IL-2, IL-4, IFNγ, and HPRT, and calculating the IL-4/IFNγ ratios. In- tranasal challenge was performed on day 14, 15 and 16 (days 0, 1, and 2 after transfer) ... CCL21 and CCL19, and cell bound TNF family ligand lymphotoxin beta (LTβ), have been associated with numerous chronic inflammatory diseases. A general role in chronic inflammato...

Ngày tải lên: 03/11/2012, 11:24

... protein crystallography. Acta Crystallogr D Biol Crystallogr 50, 760–763. 31 Vagin A & Teplyakov A (2000) An approach to multi- copy search in molecular replacement. Acta Crystallogr D Biol Crystallogr ... Biochemistry 45, 6615–6627. 24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthine guanine phosphoribosyltransferase expands subst...

Ngày tải lên: 15/02/2014, 01:20

... were synthesized chemically and preliminary studies on antibacterial activity showed that the quality and biological activity of native and synthesized toxins were identical. Due to a shortage of native ... isolation and charac- terization of amphipathic a- helical peptides from the venom of Opistophtalmus carinatus, a scorpion living in southern Africa, and we have m...

Ngày tải lên: 21/02/2014, 15:20

... data of A ˚ kerfeldt et al. [29] agrees with the large body of independent data collected on Calb and truncated Calbs by Kumar’s group. This latter work revealed that EF-hands II and VI of Calb ... products of CR I–II. We thank Walter Chazin (Vanderbilt University, Nashville) for critical evaluation of the manuscript and Barbara Zarzycka (Warsaw) for her technical assistance...

Ngày tải lên: 22/02/2014, 07:20

... trifluoroacetic acid] over 80 min. Amino-acid analysis and sequencing Peptide amino-acid analyses and automatic amino-acid sequence determination by Edman degradation were carried out in an Applied ... [13]. Chromatographic analysis Gel-filtration analysis of pure calhepatin was performed as described by Drohat et al. [7] by FPLC on a Superose 12 HR 10/30 column (Pharmacia) calibrated w...

Ngày tải lên: 08/03/2014, 22:20

... molecular mass markers used as standards for gel filtration chromatography were b-amylase (200 kDa), aspartate aminotransferase (90 kDa), ribosome inactivating protein (29 kDa) and onconase (11.8 kDa). Other ... of the renaturation and purification procedures to chelate iron and prevent cluster formation. Enzymatic assays of Tomo F reductase activity NADH acceptor reductase activity...

Ngày tải lên: 17/03/2014, 10:20

... O-speci®c polysaccharides in a yield of 20% of the LPS mass. Rabbit antisera and serological assays Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P. ... Drzewiecka 1 , Nikolay P. Arbatsky 2 , Alexander S. Shashkov 2 and Yuriy A. Knirel 2 1 Department of General Microbiology, Institute of Microbiology and Immunology, Unive...

Ngày tải lên: 17/03/2014, 17:20