Báo cáo Y học: Unfolding and refolding studies of frutalin,

Báo cáo Y học: Unfolding and refolding studies of frutalin, a tetrameric D-galactose binding lectin doc

... Unfolding and refolding studies of frutalin, a tetrameric D -galactose binding lectin Patricia T. Campana 1 , Derminda I. Moraes 1 , Ana C. O. Monteiro-Moreira 1,2 and Leila M. Beltramini 1 1 Instituto ... recombinant human promatrilysin [23]. Figure 3 shows the CD spectra for Th and Ch of the Nfrutalin, Ufrutalin, Rfrutalin and Mfrutalin forms. Nfrut- alin had a...

Ngày tải lên : 17/03/2014, 23:20

6
403
0

Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot

... sense 5¢-ATTTCTGTATTC AAGCTGGAGGCAGAGCCGTG AT-3¢,antisense5¢-CTGCCTCCAGC TTGAATACAG AAATG-3¢; N424D, sense 5¢-AGATTTGGG GATAC TTCATCTAGCTCAATTT-3¢,antisense5¢-AGATGAAGT ATCCCCAAATCTATGTAACG-3¢; ... recombinant FAE1 KCS was active with several acyl-CoA substrates, with highest activity towards saturated and monounsaturated C16 and C18. In the absence of an acyl-CoA substrate, FAE1 KCS wa...

Ngày tải lên : 24/03/2014, 03:21

9
457
0

Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

... contributions All authors made substantial contributions to conception and design, and to the analysis and interpretation of the data. TRM and GWC handled acquisition of data. All authors contributed ... study include evaluation of a large number of patients participating in an RA registry at 11 VHA medical centers. All patients had rheumatologist-confirmed RA and well-...

Ngày tải lên : 25/10/2012, 10:45

29
581
0

Báo cáo y học: " Induction and effector phase of allergic lung inflammation is independent of CCL21/CCL19 and LT-beta

... by real-time PCR analysis of RNA for IL-2, IL-4, IFNγ, and HPRT, and calculating the IL-4/IFNγ ratios. In- tranasal challenge was performed on day 14, 15 and 16 (days 0, 1, and 2 after transfer) ... CCL21 and CCL19, and cell bound TNF family ligand lymphotoxin beta (LTβ), have been associated with numerous chronic inflammatory diseases. A general role in chronic inflammato...

Ngày tải lên : 03/11/2012, 11:24

8
622
0

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... protein crystallography. Acta Crystallogr D Biol Crystallogr 50, 760–763. 31 Vagin A & Teplyakov A (2000) An approach to multi- copy search in molecular replacement. Acta Crystallogr D Biol Crystallogr ... Biochemistry 45, 6615–6627. 24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthine guanine phosphoribosyltransferase expands subst...

Ngày tải lên : 15/02/2014, 01:20

11
770
0

Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

... were synthesized chemically and preliminary studies on antibacterial activity showed that the quality and biological activity of native and synthesized toxins were identical. Due to a shortage of native ... isolation and characterization of amphipathic a- helical peptides from the venom of Opistophtalmus carinatus, a scorpion living in southern Africa, and we have m...

Ngày tải lên : 21/02/2014, 15:20

12
598
0

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

... data of A ˚ kerfeldt et al. [29] agrees with the large body of independent data collected on Calb and truncated Calbs by Kumar’s group. This latter work revealed that EF-hands II and VI of Calb ... products of CR I–II. We thank Walter Chazin (Vanderbilt University, Nashville) for critical evaluation of the manuscript and Barbara Zarzycka (Warsaw) for her technical assistance...

Ngày tải lên : 22/02/2014, 07:20

9
648
0

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungﬁsh (Lepidosiren paradoxa) docx

... triﬂuoroacetic acid] over 80 min. Amino-acid analysis and sequencing Peptide amino-acid analyses and automatic amino-acid sequence determination by Edman degradation were carried out in an Applied ... [13]. Chromatographic analysis Gel-ﬁltration analysis of pure calhepatin was performed as described by Drohat et al. [7] by FPLC on a Superose 12 HR 10/30 column (Pharmacia) calibrated w...

Ngày tải lên : 08/03/2014, 22:20

9
445
0

Báo cáo Y học: Expression and puriﬁcation of the recombinant subunits of toluene/ o-xylene monooxygenase and reconstitution of the active complex potx

... molecular mass markers used as standards for gel ﬁltration chromatography were b-amylase (200 kDa), aspartate aminotransferase (90 kDa), ribosome inactivating protein (29 kDa) and onconase (11.8 kDa). Other ... of the renaturation and puriﬁcation procedures to chelate iron and prevent cluster formation. Enzymatic assays of Tomo F reductase activity NADH acceptor reductase activity...

Ngày tải lên : 17/03/2014, 10:20

11
478
0

Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

... O-speci®c polysaccharides in a yield of 20% of the LPS mass. Rabbit antisera and serological assays Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P. ... Drzewiecka 1 , Nikolay P. Arbatsky 2 , Alexander S. Shashkov 2 and Yuriy A. Knirel 2 1 Department of General Microbiology, Institute of Microbiology and Immunology, Unive...

Ngày tải lên : 17/03/2014, 17:20

6
560
0