Báo cáo khoa học: " Focusing on focus: a formalization" pptx

... what can be 2 Again here we are aware of the argument that activation is a continous rather than a discrete concept. Due to space limit we only discuss a few major points here; for an elaborate ... state of DM in relation to KS sAz ~/AZ Figure 2" ;On- line' state of DM in relation to KS; AZ, SAZ & IAZ IAZ Figure 2 deserves more explanation as the on- line stat...

Ngày tải lên: 17/03/2014, 23:20

... ball across the penalty area to Alan Shearer who heads into the back of the net at the far post and scores. Logical form: score( A) & theta( A, agnt,'Alan Shearer') & head( C) & ... way, way, over. Logical Form: not (be( A) & theta( A f agnt,'Jaap Stem') & theta( A, char, B) & next( B) & score( C)& theta( C,agnt,'Jaap Stam')...

Ngày tải lên: 31/03/2014, 20:20

... and event elements it contains. 5 Evaluation 5.1 Dataset and Evaluation Metrics DUC 2001 dataset is employed to evaluate our summarization approaches. It contains 30 clus- ters and a total ... triples. After analysis of triples they connect nodes (words or phrases) by way of se- mantic relationships. Yoshioka and Haraguchi (2004) adopt a similar approach to build a map, but they...

Ngày tải lên: 17/03/2014, 04:20

... There is also in many cases a confusion between a spatial and a temporal sense, as in 'ante,' which as a preposition can mean either 'in front of (in space) or 'before' ... either an adverb or a pronoun 'que' may be either a conjunction, an interrogative pronoun, or a relative pronoun; 'bastante' may be either an adjective or an...

Ngày tải lên: 23/03/2014, 13:20

... Restrictions on Tree Adjoining Languages Giorgio Satta Dip. di Elettronica e Informatica Universit£ di Padova 35131 Padova, Italy satta@dei, unipd, it William Schuler Computer and Information ... grammar, and Schabes and Waters forbid wrap- ping auxiliaries altogether, at any node in the grammar. We now focus on the recognition problem, and informally discuss the computational...

Ngày tải lên: 31/03/2014, 04:20

... CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ⁄ W168F ⁄ Y74W TCA CCGGTCCATGATCCATT ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and...

Ngày tải lên: 18/02/2014, 11:20

... Preparation of mitochondria from animal tissues and yeasts. In Subcellular components. Preparation and Fractionation (Birnie, G.D., ed.), pp. 77–91. Butterworths, London. 38. Gornall, A. G., Bardawill, ... membrane potential; mitochondria; mitochond- rial DNA; targeting. Mammalian mitochondrial DNA (mtDNA) encodes 13 polypeptides and the RNA machinery for their transcrip- tion and translatio...

Ngày tải lên: 20/02/2014, 11:20

... molecular mass standards. Small angle X-ray solution scattering with synchrotron radiation. Data were collected on the X33 camera of the European Molecular Biology Laboratory outstation at Hasylab at ... detail, a coupled optical assay was elaborated with alcohol dehydrogenase as auxiliary enzyme, catalysing the aldehyde–alcohol conver- sion similar to the assays established for pyruvate...

Ngày tải lên: 08/03/2014, 02:20

... – L-Gulono-c-lactone oxidase [145] N 1 Animal VAO – L-Gluconolactone oxidase [146] N 3 Fungus VAO – L-Galactonolactone oxidase [147] N 1 Yeast VAO – D-Arabinono-1,4-lactone oxidase [148] Yeast VAO – Sorbitol ... This artifi- cial covalent flavinylation (again, FAD is linked via an 8-carbon rather than 8a- carbon linkage) resulted in an increased k cat value with d-alanine from 1.5 s )1 for the...

Ngày tải lên: 16/03/2014, 01:20

... protein assay kit (Biorad Laboratories). Densitometric analysis Each band, when mentioned, was analysed by alpha digi- doc 1201 software (Alpha Innotech Corporation, San Leandro, CA, USA). The same ... on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells Amit K. Pandey, Vikash Bhardwaj* and Malabika Datta Inst...

Ngày tải lên: 16/03/2014, 02:20