Báo cáo khoa học: "Subcat-LMF: Fleshing out a standardized format for subcategorization frame interoperability" potx

... Introduction Computational lexicons providing accurate lexical-syntactic information, such as subcatego- rization frames (SCFs) are vital for many NLP applications involving parsing and word sense disambiguation. ... Springer-Verlag. Aljoscha Burchardt, Katrin Erk, Anette Frank, Andrea Kowalski, Sebastian Pad ´ o, and Manfred Pinkal. 2006. The SALSA Corpus: a German Corpus Re- source for...

Ngày tải lên: 17/03/2014, 22:20

... start codon (ATG). Primers with the fol- lowing sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis thaliana L-galac- tono-1,4-lactone dehydrogen...

Ngày tải lên: 07/03/2014, 12:20

... stromal cell-derived factor (SDF) -1alpha. Glycobiology 10, 21– 29. 34 Valenzuela-Fernandez A, Palanche T, Amara A, Mage- rus A, Altmeyer R, Delaunay T, Virelizier JL, Baleux F, Galzi JL & Arenzana-Seisdedos ... 23916–23925. 28 Takei Y, Kadomatsu K, Yuzawa Y, Matsuo S & Muramatsu T (2004) A small interfering RNA targeting vascular endothelial growth factor as cancer therapeu- tic...

Ngày tải lên: 16/03/2014, 18:20

... emphasize that the predicate is intransitive and it may have a locative adjunct. Similarly, a T.OBJECT link is added from “kitap” to “okudu˘gum”. Similar labels were added to the treebank manually ... Phenomena such as traces and pro- drop are not modelled in the treebank. A word 74 Kapinin kenarindaki duvara dayanip bakti bir an . lean looked one momentDoor+GEN Side+LOC+REL wall+DAT PO...

Ngày tải lên: 17/03/2014, 06:20

... so called Parsing as Deduction hypothesis. In particular it has been shown that meta.interpreters or program transformations can be used to affect the manner in which a logic grammar is parsed ... information, i.e. the 'nodes' or feature-bundles which are fundamental to the representation, and 2) units of structure, the minimal structural 'schema' for relating &a...

Ngày tải lên: 18/03/2014, 02:20

... the critical b-lactam ring and render the antibiotic inactive against its original cellular target, the cell wall transpeptidase. b-Lactamases of Keywords class C b-lactamase; cold adaptation; psychrophile; ... 43.6, Table 3. Percentage identity between the four b-lactamases and rmsd values (A ˚ ) for C a atoms among the four studied enzymes. Parame- ters potentially involved in thermal...

Ngày tải lên: 23/03/2014, 07:20

... Design of a Computer Language for Linguistic Information Stuart M. Shieber Artificial Intelligence Center SRI International and Center for the Study of Language and Information Stanford University ... linguistics towards declarativeness in gram- mar formalisms for instance, lexical-functional grammar (LFG) [Bresnan, 83], generalized phrase-structure gram- mar (GPSG) [Gazdar...

Ngày tải lên: 24/03/2014, 01:21

... trees. As Kmch and Jmhi point out, this means that a TAG is incomplete ms an account of the structure of a natural language, e.g. a TAG grammar wW contain ~th an active and a passive form ... Adj~g Grammars, or "TAG's', (Josh/, Levy & Takahash/ 1975; Josh/ 1983; Kroch & Josh/ 1965) we~ developed as an al~ma~ive to the aandard tyntac~ formalisms t...

Ngày tải lên: 24/03/2014, 02:20

... glutaryl acylases on substrates with adipyl and a- aminoadipyl side chains varies greatly. As the glutaryl, adipyl and a- aminoadipyl side chains are all very similar, it can be envisaged that a ... b-lactam acylase family (EC 3.5.1.11) are capable of catalysing the deacylation reaction needed to produce the b-lactam nucleus from naturally occurring b-lactams. The b-lactam acylases have t...

Ngày tải lên: 31/03/2014, 09:20

... for German verbs whose results agree with a manual classification in many respects and should prove useful as automatic basis for a large-scale cluster- ing. Without any doubt the cluster analysis ... strongly determined by Lebewesen for both 'n' and `na' and Nahrung for `na'. fahren `to drive' chooses typical manner of mo- tion frames ('n', `n...

Ngày tải lên: 17/03/2014, 22:20