Báo cáo khoa học: "The Best of Both Worlds – A Graph-based Completion Model for Transition-based Parsers" pot

Tài liệu Báo cáo khoa học: The occurrence of hemocyanin in Hexapoda docx

... Campodeidae Juvenile, adult – – Machilis germanica Archeognatha Machilidae Adult MgeHc1 – Ephemerella mucronata Ephemeroptera Ephemerellidae Juvenile – – Aeshna cyanea Odonata Aeshnidae Adult – – Locusta ... Blattaria Blaberidae Juvenile, adult BduHc1 BduHc2Periplaneta americana Blattaria Blattidae Juvenile, adult PamHc1 PamHc2Shelfordella lateralis Blattaria Blattidae Juvenile, adult SlaHc1 SlaHc2Graphosoma ... – Folsomia candida Collembola Isotomidae Juvenile, adult FcaHc1 – Allacma fusca Collembola Sminthuridae Adult – – Acerentomon franzi Protura Acerentomidae Juvenile – – Campodea sp. Diplura Campodeidae...

Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf

... 369, 32 1– 325.22 Rao CM, Raman B, Ramakrishna T, Rajaraman K,Ghosh D, Datta S, Trivedi VD & Sukhaswami MB(1998) Structural perturbation of a- crystallin and itschaperone-like activity. ... after25 min and reached a plateau after 90 min. Theamount of DTT-induced aggregation of a- lactalbuminwas increased in a concentration-dependent manner bythe addition of Gly, such that, at 250 mm, ... turbidity assays (seebelow). The effect of the additives on aggregation of thetarget protein (in the absence and presence of aB-crystallin)was assessed at the end of each assay by calculating...

Tài liệu Báo cáo khoa học: The sequentiallity of nucleosomes in the 30 nm chromatin ﬁbre pptx

... conformation. It consists of a regular helixwith a diameter of approximately 33 nm and a variablemass per unit length, which approaches 0.6 nucleo-somesÆnm)1with an 11 nm pitch at 80 mm salt ... L, Koch MH, Vega MC & NaveC (1986) The superstructure of chromatin and its con-densation mechanism. II. Theoretical analysis of theX-ray scattering patterns and model calculations. EurBiophys ... one for repeat lengths below 210 bp with a diameter of 33 nm and another for repeat lengths above210 bp with a diameter of 45 nm and with the ﬂatsurfaces of the nucleosomes close to parallel...

Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

... benzo [a] pyrene-2¢-deoxyguanosineadducts affects DNA methylation by SssI and HhaI DNAmethyltransferasesOksana M. Subach1, Diana V. Maltseva1, Anant Shastry2, Alexander Kolbanovskiy2,Saulius Klimasˇauskas3, Nicholas ... 5¢-d(CCTATAGATATCC). Carcinogenesis 15, 220 7–2 213.57 Kumar S, Cheng X, Pﬂugrath JA & Roberts R (1992)Puriﬁcation, crystallization and preliminary X-raydiffraction analysis of an M.HhaI–AdoMet ... constant; M.SssI, SssI DNA methyltransferase;M.HhaI, HhaI DNA methyltransferase; MTase, DNA methyltransferase; V0, initial rate of methylation; Vmax, maximal rate of methylation.FEBS Journal...

Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx

... mutations that affect the extracellulardomain and the stop codon.AbbreviationsACH, achondroplasia; BFA, brefeldin A; Cbl, casitas B-lineage lymphoma; ECD, extracellular domain; EGFR, epidermal growth ... developmental delay andacanthosis nigricans (SADDAN) [12], whereas replace-ment of lysine by asparagine or glutamine (K650N ⁄ Q)is associated with hypochondroplasia [13]. Based onseveral in vitro and ... & Liboi E (2003) The thanatophoric dys-plasia type II mutation hampers complete maturation of ﬁbroblast growth factor receptor 3 which activates sig-nal transducer and activator of transcription...

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherﬁsh Misgurnus fossilis Functional consequences for the enzyme ppt

... ACGAAACCTGGCAGAGTCCAAG B6R5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R7 both forward CAGAAAAAGACAAGGAGGAC F19RIsoform-speciﬁc PCR 8 both forward ... & PCR 1 both forward GTGGACGTGATGGAGGATAAG A1 F 728 (with A1 F and A1 R)2 reverse GAAGGCACGCTGAGGAAGAC A1 R5’-RACE 3 both outer reverse GGATGAATGCCCAACTTCTCCC B13R4 both outer reverse ACGAAACCTGGCAGAGTCCAAG ... short forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA...

Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf

... AM, Columbaro M, Scarano G, MattioliE, Sabatelli P, et al. (2005) Alterations of nuclear envel-ope and chromatin organization in mandibuloacral dys-plasia, a rare form of laminopathy. Physiol ... phylalike cnidaria or nematodes and four major forms inmammals, designated A- type (lamin A and lamin C)and B-type (lamin B1 and lamin B2), in addition to anincreasing number of associated ... [13].Hence, a speculative ancestral lamin gene stands at theorigin of the 65 IF genes that we know for human atpresent [14]. The fact that human harbours only threegenes for lamins – lamin A and C are...

Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

... the mutant HHP-RNase is very similar to that of RNase-AA-GG as the presence of Glu111 is coun-terbalanced by basic residues not present on RNase-AA-GG.This material is available as part of the ... insignal transduction and vesicle trafﬁcking, speciﬁcallyassociate to negatively charged membranes.As all these data are suggestive of a role of mem-branes, in particular of negatively charged ... RNase A Monomeric 9.8 > 200RNase-AA A1 9P,Q28L,K31C,S32C-RNase A Dimeric 9.6 82RNase-AA-G D38G-RNase-AA Dimeric 9.8 64RNase-AA-GG D38G,E111G-RNase-AA Dimeric 9.9 27HP-RNase Human pancreatic...

Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

... yeast mutants blocked at various sta-ges of transport pathways are an invaluable method for unravelling the molecular details of vacuolar and lysosomal traf-ﬁc. The activities of lysosomes are ... syndrome and adipocytokinesY. MatzuzawaDepartment of Internal Medicine and Molecular Science, GraduateSchool of Medicine Osaka University, Osaka, JapanVisceral fat accumulation plays crucial roles ... fromstudies on Saccharomyces cerevisiae. A good example is vacuolar/lysosomal transport, as the yeast vacuole is analogous to themammalian lysosome, and trafﬁcking to both organelles isremarkably conserved....

Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx

... for Ala hadcaused any change in the catalytic activity of RTA, theN-glycosidase activity of RTA N12 2A against yeast ribo-somes was determined and compared to that of wild-typeRTA (Fig. 6A) . ... Table 1.Assay of theN-glycosidase activity of ricin A chainvariantsThe activity of each of the RTA variants was determinedby assessing their ability to depurinate 26S rRNA of Table 1. Data ... by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressingvalues as a percentage.Reassociation and quantiﬁcation of ricin A- chain variantsPuriﬁed RTA (100 lg) was mixed...

Xem thêm