... Campodeidae Juvenile, adult – – Machilis germanica Archeognatha Machilidae Adult MgeHc1 – Ephemerella mucronata Ephemeroptera Ephemerellidae Juvenile – – Aeshna cyanea Odonata Aeshnidae Adult – – Locusta ... Blattaria Blaberidae Juvenile, adult BduHc1 BduHc2 Periplaneta americana Blattaria Blattidae Juvenile, adult PamHc1 PamHc2 Shelfordella lateralis Blattaria Blattidae...
Ngày tải lên: 18/02/2014, 08:20
... 369, 32 1– 325. 22 Rao CM, Raman B, Ramakrishna T, Rajaraman K, Ghosh D, Datta S, Trivedi VD & Sukhaswami MB (1998) Structural perturbation of a- crystallin and its chaperone-like activity. ... after 25 min and reached a plateau after 90 min. The amount of DTT-induced aggregation of a- lactalbumin was increased in a concentration-dependent manner by the addition of Gly, s...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: The sequentiallity of nucleosomes in the 30 nm chromatin fibre pptx
... conformation. It consists of a regular helix with a diameter of approximately 33 nm and a variable mass per unit length, which approaches 0.6 nucleo- somesÆnm )1 with an 11 nm pitch at 80 mm salt ... L, Koch MH, Vega MC & Nave C (1986) The superstructure of chromatin and its con- densation mechanism. II. Theoretical analysis of the X-ray scattering patterns and model calcu...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx
... benzo [a] pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases Oksana M. Subach 1 , Diana V. Maltseva 1 , Anant Shastry 2 , Alexander Kolbanovskiy 2 , Saulius Klimas ˇ auskas 3 , Nicholas ... 5¢-d (CCTATAGATATCC). Carcinogenesis 15, 220 7–2 213. 57 Kumar S, Cheng X, Pflugrath JA & Roberts R (1992) Purification, crystallization and preliminary X-...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx
... mutations that affect the extracellular domain and the stop codon. Abbreviations ACH, achondroplasia; BFA, brefeldin A; Cbl, casitas B-lineage lymphoma; ECD, extracellular domain; EGFR, epidermal growth ... developmental delay and acanthosis nigricans (SADDAN) [12], whereas replace- ment of lysine by asparagine or glutamine (K650N ⁄ Q) is associated with hypochondroplasia [13]. Based on se...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific PCR 8 both forward ... & PCR 1 both forward GTGGACGTGATGGAGGATAAG A1 F 728 (with A1 F and A1 R) 2 reverse GAAGGCACGCTGAGGAAGAC A1 R 5’-RACE 3 both outer reverse GGATGAATGCCCAACTTCTCCC B13R 4 bo...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf
... AM, Columbaro M, Scarano G, Mattioli E, Sabatelli P, et al. (2005) Alterations of nuclear envel- ope and chromatin organization in mandibuloacral dys- plasia, a rare form of laminopathy. Physiol ... phyla like cnidaria or nematodes and four major forms in mammals, designated A- type (lamin A and lamin C) and B-type (lamin B1 and lamin B2), in addition to an increasing number of ass...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx
... the mutant HHP-RNase is very similar to that of RNase-AA-GG as the presence of Glu111 is coun- terbalanced by basic residues not present on RNase- AA-GG. This material is available as part of the ... in signal transduction and vesicle trafficking, specifically associate to negatively charged membranes. As all these data are suggestive of a role of mem- branes, in particular of neg...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx
... yeast mutants blocked at various sta- ges of transport pathways are an invaluable method for unravelling the molecular details of vacuolar and lysosomal traf- fic. The activities of lysosomes are ... syndrome and adipocytokines Y. Matzuzawa Department of Internal Medicine and Molecular Science, Graduate School of Medicine Osaka University, Osaka, Japan Visceral fat accumulation pla...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx
... for Ala had caused any change in the catalytic activity of RTA, the N-glycosidase activity of RTA N12 2A against yeast ribo- somes was determined and compared to that of wild-type RTA (Fig. 6A) . ... Table 1. Assay of the N -glycosidase activity of ricin A chain variants The activity of each of the RTA variants was determined by assessing their ability to depurinate 26S rRN...
Ngày tải lên: 19/02/2014, 12:20