Báo cáo khoa học: "Toward a Redefinition of Yea/No Questions" pot
... any set of referents {bl, ,bn} that can be partially ordered by a relation O s can support scalar implicature. Any scale S that permits scalar implicature can be represented as a partiallg-ordered ... as b~,th members of a set of Hawaiian cities, he can affirm an unqueried set member (ltilo) to deny a queried member {llawaii). The affirmati,~n of an unqueried ah,'...
Ngày tải lên: 17/03/2014, 19:21
... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker meaning- driven, as ... be able to derive the discourse relations holding between adjacent text spans, and also to notice the additional semantic and pragmatic implications stemming from the usage of a...
Ngày tải lên: 20/02/2014, 18:20
... recognize any given instance of the concept Canada constitutes our concept of Canada. According to a second view, Kant considers a concept as an abstract represen- tation (vorstellung) of the ... TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS Fernando Gomez Department of Computer Science University of Central Florida Orlando, Florida 32816 ABSTRACT An...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
... GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–463 R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaI rFnBPB 163–308 F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–308 R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... GAATTATCTTTAGCTCTAGCTATTGATCC rFnBPB 163–480 NF F GGATCAATAGCTAGAGCTAAAGATAATTC FnBPB (–142–480) F GCAGAATTCGTCGGCTTGAAATACGCTG EcoRI FnBPB (–142–480) R AATGGATCCTTACTTTAGTTTATCTTTGCCG Bam...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx
... et al. (2005). The re- search established that even a small amount of ad- ditional training data can give a substantial im- provement in question analysis in terms of both CFG parse accuracy and ... from appropri- ate treebank material. However, treebank- and machine learning-based grammatical resources re- flect the characteristics of the training data. They generally underperform o...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Macrocypins, a family of cysteine protease inhibitors from the basidiomycete Macrolepiota procera pot
... cysteine proteases papain, cathepsin L and cathepsin V using benzyloxycar- bonyl (Z)-Phe-Arg-7-amido-4-methylcoumarin (AMC) as substrate, and for legumain with Z-Ala-Ala-Asn-AMC as the substrate, while ... pooled, concentrated by ultrafiltration (Amicon UM-10; Millipore, Vienna, Austria) and dialyzed against 0.02 m Tris–HCl, pH 7.5. The sample was then applied to a column of DEAE– Sephacel...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: "Generating a Table-of-Contents" pptx
... Table -of- Contents S.R.K. Branavan, Pawan Deshpande and Regina Barzilay Massachusetts Institute of Technology {branavan, pawand, regina}@csail.mit.edu Abstract This paper presents a method for the auto- matic ... Most of these approaches are tailored to a par- 1 The code and feature vector data for our model and the baselines are available at http://people.csail.mit.edu/branavan/code...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf
... a single value. Moreover, default specifications can be made to act as indefeasible information, using YADU's DefFill operation (Las- carides and Copestake, 1999), that has a TDFS as ... ties about classes of items that behave similarly. This idea is employed in Pollard and Sag's (1987) sketch of an HPSG lexicon as a monotonic mul- tiple orthogonal inheritance typ...
Ngày tải lên: 17/03/2014, 23:20
Tài liệu Báo cáo khoa học: "The Incremental Generation of Passive Sentences" pot
... auxil- iary is treated as an argument-attraction verb (cf. Hinrichs & Nakazawa 1991): It subcategorizes for a passive participle and attracts the arguments that the par- ticiple subcategorizes ... other approaches to the computational modelling of empirically substantiated features of human language production, such as Kempen & Hoenkamp's (1987) Incremental Procedura...
Ngày tải lên: 22/02/2014, 10:20
Tài liệu Báo cáo khoa học: "Experiments in Reusability of Grammatical Resources" pot
... Experiments in Reusability of Grammatical Resources Doug Arnold ° Toni Badia ®, Josef van Genabith% Stella Markantonatou ° Stefan Momma% Louisa Sadler °, Paul Schmidt ° °Dept of Language and Linguistics, ... automatic, semi-automatic and manual migration of implemented grammatical and lexical resources and of textbook specifications, writ- ten in various 'styles', to t...
Ngày tải lên: 22/02/2014, 10:20